J Korean Soc Cosmetol > Volume 27(2); 2021 > Article
신규 화장품 소재로서 Lactobacillus plantarum HDB1234 용암해수 발효물의 피부장벽강화 효과

Abstract

In this study, we developed Lava-Dermabiotics HDB1234 using Lactobacillus plantarum HDB1234 and lava seawater fermentation technology to enhance skin barrier. The use of lava seawater increased the purity and concentration of nucleotides in Lava-Dermabiotics HDB1234 by using nanodrop 2000 spectrophotometer. Also, when 5%(v/v) Lava-Dermabiotics HDB1234 was treated, cytotoxicity on normal human epidermal keratinocytes (NHEKs) and human fibroblast cells was not observed by using MTT assay. The mRNA expressions of claudin-1 (CLDN-1), serine palmitoyltransferase (SPT), and filaggrin (FLG) on Lava-Dermabiotics HDB1234 treated cells were dose-dependent higher than those of non-treated cells. Especially, the protein expression of FLG was also confirmed by using western blotting and immunocytochemistry staining. These results indicated that Lava-Dermabiotics HDB1234 could be used as a potential cosmetic ingredient for skin barrier enhancement through CLDN-1, SPT, and FLG expression related to the formation of skin barrier.

I. 서 론

피부의 최외각에 위치한 표피는 체내의 수분손실을 막고 미생물 및 자외선(UV)과 같은 자극으로부터 피부를 보호하는 장벽기능을 수행하고 있다(Kim & Lee, 2008). 표피는 각질형성 세포(kerationcyte)의 분화 정도에 따라 각질층, 과립층, 가시층 및 바닥층으로 나뉘며, 각질세포막, 각질세포간 지질, 천연보습 인자(natural moisturizing factor) 및 밀착연접(tight junction)에 의해 피부장벽이 유지된다(Kim et al., 2011; Kim et al., 2013). 각질형성세포는 과립층과 각질층에서 천연보습인자, 세라마이드(ceramide), 콜레스테롤(cholesterol) 및 지방산 등의 각질세포 간 지질을 형성하여 피부보습과 각질층의 약산성을 유지하고 있다(Kim & Kim, 2017). 이 중, 세라마이드는 각질세포간 지질의 40%를 차지하며, serine palmitoyltransferase (SPT)에 의해 serine과 palmitoyl-CoA가 결합되어 세라마이드 합성과정이 시작된다. 과립층에서는 involucrin (INV), filaggrin (FLG), loricrin (LOR) 등의 각질세포막 단백질들이 교차 결합되어 단단한 구조가 만들어 진다. 특히, FLG는 케라틴 중간 미세섬유에 달라붙어 강한 물리적 지지력을 제공하고 이후 pyrrolidone carboxylic acid (PCA), trans-urocanic acid (trans-UCA) 같은 아미노산과 여러 대사산물로 분해돼 천연보습인자를 형성하게 된다(Yu et al., 2015). 또한, occludin (OCC), claudin (CLDN), junctional adhesion molecule (JAM), zonula occludens proteins (ZO) 등으로 이루어진 과립층 세포의 밀착연접은 액체의 이동을 조절하여 피부보습을 유지하는 역할을 하고 있다(So et al., 2019).
프로바이오틱스(probiotics)는 인체에 유용한 건강기능효과를 주는 미생물로 유산균(lactic acid bacteria)이 가장 대표적인 균주로 알려져 있다. 유산균은 Lactobacillus, Streptococcus, Enterococcus, Pediococcus 속 등의 미생물을 포함하는 혐기성균으로 주로 사람의 장이나 여성의 질에 서식하고 있으며, 김치나 발효유 등 발효식품의 스타트 종균(starter culture)으로 널리 사용되고 있다(Chapot-Chartier & Kulakauskas, 2014). 또한, 유산균의 기능성연구가 활발히 진행되고 있는데, 설사 및 과민성대장증후군 증상완화와 같은 장건강효과 외에도 유산균 섭취가 아토피피부염 증상완화, 피부보습 증가 등 피부건강에도 효과가 있다고 보고되어 있다(Jeong et al., 2015; Kerry et al., 2018; Kim et al., 2015). 기존까지는 유산균 섭취를 통해 피부건강효과를 입증한 연구가 대다수였으나 최근 들어 유산균 세포파쇄물(cell lysate)을 피부에 발라 기능성을 확인하는 연구가 증가하고 있는 추세이다. 특히, 가열, 초음파파쇄, 가압 등 다양한 방식을 통해 유산균의 세포벽을 파쇄하여 유산균의 세포벽과 세포질 성분을 이용한 유산균 세포 파쇄물의 미백 및 주름개선 효과가 보고되고 있다(Kim & Lee, 2015; Lim et al., 2020).
또한, 유산균과 피부 마이크로바이옴 형성의 연관성 대한 새로운 연구결과가 보고되고 있는데 그 일례로 질내 미생물 이식(virginal seeding)을 들 수 있다. 태아는 산모의 자궁에서 출산 직전까지 무균상태를 유지하며 성장하다가 출산과 더불어 다양한 외부 환경의 미생물들과 접촉하게 된다(Heo et al., 2019). 이때, 자연분만 방식으로 태어난 신생아에 비해 제왕절개 방식으로 태어난 신생아가 아토피피부염 및 건선과 같은 피부면역질환으로 진행되기 쉬웠는데 이는 자연분만 방식으로 태어난 신생아의 피부에 산모의 질에 존재하는 Lactobacillus 속의 유산균이 묻게 되면서 외부 미생물에 대한 방어기재 및 초기 피부 면역이 형성되었기 때문으로 추정하고 있다(Dominguez-Bello et al., 2010; Dominguez-Bello et al., 2016).
용암해수는 민물과 바닷물이 현무암층을 통해 여과되어 생성되는 지하수로 제주지역만의 독특한 수자원이다(Lee et al., 2016). 용암해수는 다른 수자원과는 다르게 나트륨, 마그네슘, 칼슘, 칼륨 외에도 철, 망간, 셀레늄 등과 같은 미량 미네랄 또한 함유되어 있으며 다량의 미네랄을 활용하여 식품가공과 식물재배 뿐만 아니라 화장품소재로서도 다양하게 활용 및 연구가 진행되고 있다(Bae et al., 2012; Jung et al., 2017). 식품가공 분야에서는 유산균을 30%(v/v) 용암해수와 함께 배양하여 가공한 프로바이오틱스의 섭취 시 유산균의 소화관 안정성과 장 정착성이 증가한 결과가 보고되어 있으며(Kim et al., 2020), 화장품 분야에서는 용암해수를 각질형성세포에 처리 시 FLG, caspase-14, aquaporin-3의 발현이 증가되어 피부보습이 향상된 결과가 보고된 바 있다(Lee et al., 2016).
본 연구는 피부건강에 중요한 소재인 유산균과 용암해수를 함께 활용하여 유산균 유래 뉴클레오티드의 함량과 순도를 높이는 용암해수 발효법을 개발하고, 이를 화장품소재화 하여 피부세포독성과 피부장벽 형성에 미치는 영향을 연구하는데 목적을 두었다.

II. 재료 및 방법

1. 사용균주 및 보관

본 연구에 사용된 HDB1234 균주는 ㈜현대바이오랜드의 cell bank (HYUNDAI BIOLAND Cell Bank, HDBCB)로부터 분양받아 사용하였다. 분양종균을 활성화시키기 위해 MRS broth (BD, Becton, Dickinson and Company, New Jersey, USA)에 접종하여 37°C, 16시간 정치 배양하였다. 활성화된 유산균은 본 실험에서 스타트 종균으로 사용하기 전, 50% glycerol 용액과 1:1(v/v)로 섞어 -70°C의 deep freezer에 앰플 상태로 보관하였다.

2. 균주 동정

본 연구에 사용된 HDB1234 균주의 동정(identification)을 위해 16S ribosomal RNA 염기서열분석에 기초한 계통 유전학적 실험(phylogenetic analysis)을 수행하였다. 이를 위해 Escherichia coli의 16S rDNA 서열을 기준으로 forward primer 5'-GGGGGATCCAGAGTTTGATCCTGGCTCA-3'와 reverse primer 5'-GGGCTCGAGTACCTTGTTACGACTTCACC-3'를 제작한 후, HDB1234 genomic DNA를 추출하고 PCR로 16S rDNA를 증폭시켜 염기서열을 결정하였다. 이 서열을 기반으로 미국 국립생물정보센터(National Center for Biotechnology Information, NCBI; USA)의 Basic Local Alignment Search Tool (BLAST) 프로그램으로 유사성이 높은 Lactobacillus 속의 유산균 염기서열을 선별하고 Clustal X (Des Higgins, Germany)로 다중정렬한 후, 계통유전수를 작성하고 neighbor-joining 방법으로 그 위치를 확인하고 BLAST2 프로그램을 이용한 쌍정렬을 실시함으로써 동일 종(species)에 속하는 서열들과의 상동성(homology)을 비교하였다.

3. Lava-Dermabiotics HDB1234 제조

유산균을 이용한 피부장벽강화 화장료를 제조하기 위해 2단계 배양과정을 거쳤다. 제주용암해수 30%(v/v)가 포함된 MRS broth에 L. plantarum HDB1234가 3%(v/v)되게 접종한 후, 37°C, 24시간 1차 배양하였다. 1차 배양액을 20,000×g, 10분간 원심 분리하여 균체만을 회수하고 멸균 증류수로 2회 세척하였다. 이후, 세척한 균체를 용암해수에 접종하고 37°C, 20시간 2차 배양하였다. 2차 배양액을 0.12 MPa, 2시간 열압추출 조건으로 세포를 파쇄한 후, 4°C, 24시간 냉각 침전시키고 원심분리를 이용하여 상등액만을 회수하였다. 이후, 나노막여과 공정으로 상등액에 포함된 균체의 세포벽 등의 성분을 제거하여 고순도의 Lava-Dermabiotics HDB1234를 제조하였다. 대조군(probiotics lysate)은 일반 MRS broth에 L. plantarum HDB1234를 1차 배양하고 세척한 균체를 증류수에 2차 배양한 후, 동일한 조건으로 열압추출 및 여과하여 준비하였다.

4. Lava-Dermabiotics HDB1234의 유효성분 분석

Lava-Dermabiotics HDB1234의 뉴클레오티드(nucleotides) 함량 및 순도를 분석을 위해 nanodrop 2000 spectrophotometer (Thermo Fisher Scientific, USA)를 이용하였다(Desjardins & Conklin, 2010). Nanodrop에 상기 Lava-Dermabiotics HDB1234를 2 μL 분주한 뒤, 230 nm, 260 nm, 280 nm의 각각의 파장에서 측정된 흡광도 값을 비(ratio)로 산출하여 뉴클레오티드의 순도를 판단하였다. 각각의 흡광도는 특정 물질을 측정하는 파장으로 230 nm의 파장에서 phenol, EDTA, 유기화합물이 최대 흡광도 값을 나타내며, 260 nm의 파장에서는 뉴클레오티드(DNA, RNA)가 최대치를 나타내며, 280 nm의 파장에서는 트립신, 트립토판 등을 포함하는 단백질이 최대 흡광도 값을 나타낸다. 이중 고순도의 뉴클레오티드는 A260/A280 ratio에서 1.8-2.0 범위를 나타내며 A260/A230 ratio에서 1.8-2.2 범위를 나타낸다. 이 범위는 측정되는 blank와 sample의 pH 이온화 강도에 의해 다르게 측정될 수 있으며, acidic solutions은 0.2-0.3 낮게, basic solution은 0.2-0.3 높게 측정이 된다.

5. 세포독성

인간 표피 세포주(normal human epidermal keratinocytes, NHEKs; gibco, USA)과 인간 섬유아 세포주(human fibroblast; ATCC, USA)에 대한 Lava-Dermabiotics HDB1234의 세포독성을 3-(4,5-dimethylthoazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT; Promega, USA) assay로 측정하였다. 24-well plate에 1.5×105 cells/well의 농도로 각 세포를 접종하였다. 24시간 배양 후, Lava-Dermabiotics HDB1234를 0, 1, 2, 3, 4, 5%(v/v)의 농도로 처리하였다. 배양 후, 상등액을 제거하고 0.25 mg/mL의 MTT 용액과 반응시키고 dimethyl sulfoxide (DMSO)를 첨가하여 생성된 MTT 포르마잔(formazan)을 용해시켜 570 nm에서 흡광도를 측정하였다.

6. 피부장벽형성 관련 유전자 발현 측정

Lava-Dermabiotics HDB1234의 피부장벽강화 효과를 확인하기 위해 CLDN-1, SPT, FLG의 유전자 발현을 측정하였다(Lee et al., 2013). NHEKs 세포를 60 mm cell culture dish 에 1.0×106 cells/mL의 농도로 접종하여 37°C, 5% CO2 배양기에서 24시간 배양한 뒤, serum free Epilife 배지에 Lava-Dermabiotics HDB1234 샘플을 0, 1, 2.5, 5%(v/v) 농도로 처리하고 3일간 배양하였다. 배양이 끝나면 QIAzolTM Lysis 시약(Qiagen, Germany)을 처리하여 Applied Biosystem (USA) 방법에 따라 RNA를 추출 후 정량하였다. cDNA합성 후 real-time PCR (Applied Biosystems 7500 FAST real-time PCR system)을 수행하였다. PCR에 사용된 primers는 Table 1과 같다.

7. Western blotting

NHEKs 세포를 cell culture dish에 접종하여 37°C, 5% CO2 배양기에 24시간 배양한 후, serum free Epilife 배지로 교체하고 Lava-Dermabiotics HDB1234 샘플을 0, 1, 2.5, 5%(v/v) 농도로 처리하여 72시간 배양하였다. 배양 후, cell lysate로부터 iNtRON 제조사 방법에 따라 protein을 추출하였다. 추출한 단백질 13 μg으로 SDS-PAGE를 수행하였으며 transfer한 membrane은 5%(w/v) skim milk으로 blocking하였다. Tris buffered saline with Tween 20 (TBST)으로 세척한 후, 1차 antibody (filaggrin, Santa Cruz Biotechnology, USA)를 처리하여 4°C, O/N shaking하였다. TBST로 세척한 후, 2차 antibody (Gam-HPR, Bio-rad, USA)와 반응시켰다. TBST로 세척한 후, ECL (enhanced chemiluminescence) 용액을 처리한 다음 Chemi Doc으로 FLG의 발현을 확인하였다(Lee et al., 2013).

8. 면역형광세포염색

Lava-Dermabiotics HDB1234 처리 시, CLDN과 SPT보다 FLG 유전자가 가장 많이 발현되었으며, 각질형성 세포막 단백질과 천연보습인자 형성에 가장 중요한 인자로 작용하는 FLG에 초점을 두어 면역형광염색을 진행하였다. NHEKs 세포를 4-well culture dish에 2.5×105 cells/well의 농도로 접종하여 37°C, 5% CO2 배양기에 48시간 배양하였다. Serum free Epilife 배지로 교체한 후, Lava-Dermabiotics HDB1234 샘플을 0, 1, 2.5, 5%(v/v) 농도로 처리하여 72시간 배양하였다. 4% formaldehyde 용액을 처리한 다음 0.1% Triton X-100 용액을 처리하여 배양하였다. 그 후, 1%(w/v) bovine serum albumin (BSA) 용액으로 교체하고 filaggrin antibody를 처리하여 반응시켰다. 반응이 끝나면 Alexa Fluor 488 conjugate antibody와 반응시킨 후, DAPI (4′,6-diamidino-2-phenylindol, Sigma-Aldrich, Germany) 1 μg/mL을 처리하여 염색시킨 뒤 촬영하였다.

9. 통계분석

모든 실험결과는 독립적인 3회 반복 실험하였고, 결과는 평균값과 표준편차로 나타내었다. 이후 각 유전자의 mRNA의 상대적 발현량을 β-actin를 기준으로 비교하였으며, 통계분석은 SPSS Statics 19.0 (SPSS Inc.)를 사용하여 Mann-Whitney U test로 분석하였다.

III. 결과 및 고찰

1. HDB1234 균주의 동정

HDB1234 균주의 분자생물학적 동정은 16S rRNA 염기서열 분석 방법을 사용하였다. 분석된 1,500 bp 크기의 염기서열은 NCBI의 BLAST 프로그램을 이용하여 상동성을 비교한 결과, 100%의 신뢰도로 Lactobacillus plantarum으로 동정되었다(Fig. 1). 따라서 본 연구에 사용된 HDB1234 균주를 L. plantarum HDB1234로 명명하였으며, L. plantarum HDB1234 균주로 개발된 바르는 화장품 소재를 Lava-Dermabiotics HDB1234로 명명하였다.

2. Lava-Dermabiotics HDB1234의 유효성분 분석

Nanodrop을 사용하여 Lava-Dermabiotics HDB1234의 유효성분인 뉴클레오티드의 함량과 순도를 분석하였다. Probiotics lysate HDB1234 샘플(대조군)과 Lava-Dermabitoics HDB1234를 비교한 결과, probiotics lysate HDB1234에서 유기산 및 조단백질이 최대 흡광도를 나타내는 230 nm 및 280 nm 파장에서 상대적으로 높은 흡광도 값을 나타내었다(Fig. 2A). 반면, Lava-Dermabiotics HDB1234에서 정제된 뉴클레오티드 샘플에서 볼 수 있는 패턴을 확인하였다(Fig. 2B). 또한, Table 2에서 보는 바와 같이, 유기산, 뉴클레오티드와 조단백질이 혼합되어 있는 샘플의 순도는 각 성분의 최대 흡광파장에서의 흡광도의 비율로 계산하였다. Lava-Dermabiotics HDB1234는 A260/A280 ratio가 2.0으로 순도 유효범위인 1.8-2.0 안에 안정적인 값을 나타내었으며 A260/A230 ratio는 1.81로 순도 유효범위인 1.8-2.2 안에 안정적인 값을 나타내었다.
Lava-Dermabiotics HDB1234는 L. plantarum HDB1234를 용암해수로 배양한 후, 피부자극을 일으키는 세포벽 및 단백질, 그리고 유산균 배양과정에서 생성된 젖산을 포함하는 유기산을 제거하여, 세포 파쇄물 중 유효성분인 뉴클레오티드 함량을 높였으며 용암해수의 미네랄을 통해서 뉴클레오티드의 안정성을 유지하였다(Owczarzy et al., 2008). 기존의 화장품 원료로 사용되는 미생물 자원은 세포 파쇄물로 국제화장품원료집(International Nomenclature Cosmetic Ingredient, INCI)에서도 이를 미생물의 속(genus) 단위로 표기해 사용하고 있다(Jung et al., 2019). 따라서 분리 및 정제되지 않은 대부분의 미생물 구성성분들은 피부 표피층에 남는 성분과 피부 속으로 들어갈 수 있는 성분이 혼합되어있다. 피부 표피층에 남는 성분들은 상재균총 중 유해균의 먹이가 되어 피부 마이크로바이옴의 항상성을 저해하거나, 피부면역세포에 직접적인 자극을 유발하여 피부 발적, 홍반 등의 알레르기를 일으킬 수 있다(Bäsler & Brandner, 2017; Bergmann et al., 2020; Günzel & Yu, 2013; Hönzke et al., 2016; Wallmeyer et al., 2017). 따라서 이러한 피부 자극원을 제조과정 중에 제거하는 것이 중요하며, Fig. 2B의 Lava-Dermabiotics HDB1234와 같이 파장 별 단일성은 Lava-Dermabiotics HDB1234에서 피부를 자극할 수 있는 세포구성 성분이 선택적으로 제거되었음을 의미한다.

3. 세포독성

Lava-Dermabiotics HDB1234의 주성분은 분자량이 작은 뉴클레오티드이기 때문에 표피세포를 지나 피부 속 진피세포까지 침투가 용이하다(Nakatsuji et al., 2013). 따라서 피부 표피층의 NHEKs 세포와 피부 진피층의 human fibroblast 세포에 대한 세포독성을 MTT assay로 평가하여 안전성을 확인하였다. NHEKs 세포에 Lava-Dermabiotics HDB1234 샘플을 24시간 처리하였을 때, 모든 처리 농도군에서 대조군 대비 세포사멸(apoptosis)이 발생되지 않았으며(Fig. 3A), 오히려 1-4%(v/v)까지의 처리군에서 세포 증식이 일어나는 것을 확인하였다. Human fibroblast 세포에서도 최대 5%(v/v) 처리농도까지 세포 독성이 나타나지 않았다(Fig. 3B).
기능성 화장품 소재를 고농도로 사용할 경우 효능은 좋을 수 있으나, 부작용으로 피부독성과 홍반, 부종 등의 피부 과민반응이 나타나는 사례가 많이 보고되어 왔다(Khayyira et al., 2020). 따라서 세포 부작용은 없으면서 고효능을 나타낼 수 있는 적절한 농도구간을 확보하는 것이 중요하다. 유산균 등의 미생물을 피부 화장품 소재로 이용할 경우, 미생물을 구성하는 세포 구조체가 피부세포를 자극하고 독성을 유발할 수 있다는 보고가 있었다(Kim et al., 2015). 그람 양성균(gram positive bacteria)인 L. plantarum의 세포벽은 펩티도글리칸(peptidoglycan) 성분으로 구성되어 있으며 이외에도 테이코익산(teichoic acid)으로 불리는 폴리올(polyol) 인산이 다당에 공유결합 되어있다(Brown, 2013; Desvaux et al., 2006). 이런 세포벽 성분들은 피부알레르기를 유발할 수 있으므로 Lava-Dermabiotics HDB1234의 제조 시, 나노막여과과정을 통해 알레르겐으로 작용가능한 세포구조물 등을 제거하였다. 그 결과, NHEKs 세포와 human fibroblast 세포에서 Lava-Dermabiotics HDB1234의 세포독성은 5%(v/v) 이하의 범위에서 거의 없는 것을 확인하였으며, 최대 5%(v/v) 농도로 본 실험을 진행하였다.

4. 피부장벽형성 관련 유전자 및 단백질 발현량 측정

Lava-Dermabiotics HDB1234를 농도별로 NHEKs 세포에 처리한 후, 피부장벽 형성에 관여하는 세 가지 주요 단백질인 CLDN-1, SPT, FLG 유전자 발현량을 평가하였다(Fig. 4). Lava-Dermabiotics HDB1234를 5%(v/v) 처리 시, CLDN-1 유전자 발현량은 음성대조군 대비 1.4배 증가하였으며, 양성대조군인 락토페린보다 1.3배 높은 유전자 발현을 유도하였다(Fig. 4A). 밀착연접은 세포와 세포를 연결하는 고리로 세포간의 간격을 일정하게 유지시키고 물질의 이동과 세포간 물질의 교환을 조절하는 다중 단백질 복합체(multiprotein complexes)이다(Lee et al., 2019). 세포막에 존재하며 4개의 막관통 구조로 이루어진 CLDN-1은 밀착연접 구성 단백질 중 하나로 이전 연구에서 CLDN-1 knock out mice가 탈수증상으로 생후 1일 이내 사망한 연구사례가 있었으며, CLDN-1 이상과 아토피피부염 간의 상관관계를 입증한 보고도 있었다(Lee et al., 2013). 이러한 연관성을 통해 Lava-Dermabiotics HDB1234의 CLDN-1 발현 증가는 세포간의 부착과 세포간 간격을 규칙적으로 배열함으로써 피부보습을 유지하여 피부장벽기능 강화에 도움을 줄 수 있음을 확인할 수 있었다.
SPT의 유전자 발현량은 5%(v/v) 처리 시, 음성대조군 대비 2.1배 증가하였으며(Fig. 4B), 양성대조군인 CaCl2 처리 시 1.5배 높았다. SPT는 serine과 palmitoyl-CoA를 결합시켜 3-ketodihydrosphingosine을 생성함으로써 세라마이드 합성과정의 처음을 시작하는 효소이다. 세라마이드는 각질세포간 지질의 약 40%를 차지하며 강한 수소결합을 통해 수분유지에 큰 역할을 하는 물질로, 이전 연구에서 SPT knock out mice에서 SPT가 제기능을 하지 못해 세라마이드가 감소하여 각질층의 수분함량이 감소되고 정상적인 피부장벽이 형성되지 못해 피부 가려움과 아토피피부염 증상이 증가했다고 보고되었다(Kim et al., 2016). 이러한 연관성을 통해 Lava-Dermabiotics HDB1234의 SPT 발현 증가는 세라마이드의 합성을 촉진함으로써 피부장벽 기능을 강화할 수 있음을 나타낸다.
마지막으로 FLG 유전자 발현량은 5%(v/v) Lava-Dermabiotics HDB1234 샘플처리 시 음성대조군 대비 6.9배 증가하였으며, 양성대조군인 CaCl2 처리 때 보다 2.8배 높았다(Fig. 4C). 특히, FLG는 천연보습인자와 각질세포막 단백질의 형성에 중요하기 때문에 유전자 발현증가를 통해 실제 단백질 발현까지 이어지는지 확인하였다. FLG의 발현에 미치는 영향을 western blotting을 통해 확인한 결과, 5%(v/v) Lava-Dermabiotics HDB1234 샘플에서 FLG 발현량이 음성대조군 대비 4.1배 증가되었다(Fig. 5A). 또한, 면역형광세포염색을 통해 FLG만을 선별적으로 형광 반응시켜확인한결과, Lava-Dermabiotics HDB1234 샘플 5%(v/v) 처리한 군에서 녹색으로 염색된 FLG가 더 증가된 것을 확인할 수 있었다(Fig. 5B). 각질세포막 단백질 중 하나인 FLG는 케라틴 중간 미세섬유들(keratin filaments)을 응집시켜 견고한 피부장벽을 형성한다(Kim et al., 2013). 또한 FLG는 PCA, transUCA 같은 아미노산과 여러 대사산물로 분해돼 천연보습인자를 형성하여 피부보습, 각질층의 약산성 유지, UV 등과 같은 유해인자의 피부침투방지에 기여한다(Yu et al., 2015). 따라서 Lava-Dermabiotics HDB1234의 처리를 통한 FLG 발현 증가는 각질형성세포의 정상적인 분화를 촉진하고 추후 천연보습인자로 변환됨으로써 피부장벽기능을 강화할 수 있음을 나타낸다. 결과적으로 Lava-Dermabiotics HDB1234는 각질세포막 단백질, 세포간 지질 및 밀착연접 단백질의 발현과 천연보습인자의 생성을 증가시켜 피부장벽을 강화시킬 수 있는 화장품 소재이며, 더 나아가 아토피피부염, 건선 등 피부염의 치료제로서의 가능성을 확인할 수 있었다.

IV. 결 론

피부장벽은 건강한 피부를 유지하는데 중요한 구조이다. 본 연구에서는 피부장벽을 강화하기 위한 소재로 신규한 Lactobacillus plantarum HDB1234를 사용하였으며 용암해수를 사용한 발효법을 이용해 피부에 직접 바를 수 있는 Lava-Dermabiotics HDB1234 화장품소재를개발하였다. Lava-Dermabiotics HDB1234는 피부자극을 일으키는 세포벽, 단백질과 배양과정 중 생성된 유기산을 나노막 여과방식으로 제거하여 유효성분인 뉴클레오티드 함량을 높이고 용암해수의 미네랄을 통해 뉴클레오티드의 안정성을 유지하였다. NHEKs과 human fibroblast를 대상으로 Lava-Dermabiotics HDB1234의 세포독성을 확인한 결과, 최고 시험농도인 5%(v/v)처리 시에도 독성을 나타내지 않았으며 각각의 피부세포주의 사멸을 유도하지 않았다. Lava-Dermabiotics HDB1234는 피부장벽 형성과 관련된 단백질인 CLDN-1, SPT, FLG의 유전자 발현을 증가시켰다. 특히, 이 세가지 피부장벽 단백질 가운데 FLG의 유전자 발현량이 가장 높았으며, western blotting과 면역형광세포 분석 결과, 5%(v/v) 처리농도에서 단백질 발현량이 가장 높았다. 이러한 결과를 통해, Lava-Dermabiotics HDB1234가 피부장벽형성과 관련된 단백질들의 발현증가를 통해 피부장벽강화 효과를 가지고 있음을 알 수 있었으며, 특히 아토피피부염과 같이 FLG가 감소되어 손상된 피부를 위한 기능성 유산균 화장품 소재로서 활용될 가능성이 있음을 확인하였다.

Fig. 1.
Phylogenetic position of strain HDB1234 in the genus Lactobacillus based on the 16S rRNA sequence. The bar represented 0.01% sequence divergence.
JKSC-2021-27-2-356f1.jpg
Fig. 2.
Nanodrop measurement of probiotics lysate HDB1234 and Lava-Dermabiotics HDB1234. A230, A260, and A280 were analyzed for (A) probiotics lysate HDB1234 and (B) Lava-Dermabiotics HDB1234. Absorbance at these wavelengths were used as a measure of purity in both nucleic acid and protein extraction.
JKSC-2021-27-2-356f2.jpg
Fig. 3.
Cell cytotoxicity of Lava-Dermabiotics HDB1234 in (A) NHEKs and (B) human fibroblast. Data are shown as mean ± SD of three separate experiments (n=3). A difference between Lava-Dermabiotics HDB1234 and control was considered to be significant when * p < 0.05, ** p < 0.01, and ***p < 0.001. Cont., untreated cells; Lava-Dermabiotics HDB1234, 1-5% Lava-Dermabiotics HDB1234 treated cells.
JKSC-2021-27-2-356f3.jpg
Fig. 4.
Effect of Lava-Dermabiotics HDB1234 on skin barrier genes expression. (A) CLDN-1 gene expression; (B) SPT gene expression; (C) FLG gene expression. Data are shown as mean ± SD of three separate experiments (n=3). A difference between Lava-Dermabiotics HDB1234 and control was considered to be significant when * p < 0.05, ** p < 0.01, and ***p < 0.001. Cont., untreated cells; LF, 1.5 μM lactoferrin treated cells; CaCl2, 1.2 mM CaCl2 treated cells; Lava-Dermabiotics HDB1234, 1-5% Lava-Dermabiotics HDB1234 treated cells.
JKSC-2021-27-2-356f4.jpg
Fig. 5.
Effect of Lava-Dermabiotics HDB1234 on FLG expression. (A) FLG protein expression using immunoblotting; (B) immunofluorescence images with antibodies against FLG protein, FLG (green) are stained and DAPI (blue) was used for nuclear staining. Cont., untreated cells; Lava-Dermabiotics HDB1234, 1-5% Lava-Dermabiotics HDB1234 treated cells; CaCl2, 1.2 mM CaCl2 treated cells.
JKSC-2021-27-2-356f5.jpg
Table 1.
Sequences of skin barrier related primers
Primer Orientation Sequence (5’→3’)
Claudin-1 (CLDN-1) Forward TATGAAGTGCTTGGAAGACGATGA
Reverse AATATCGCACCCCCAATGAC
Serine palmitoyltransferase (SPT) Forward TGGTCATTTGGCCCAGGTC
Reverse TCCCAACCATTGGCTTCACATC
Filaggrin (FLG) Forward CACGTGGCAGTCCTCACAGT
Reverse CTTTTTGCCTTTCAGTGCCC
β-Actin Forward GGCACCCAGCACAATGAAG
Reverse CCGATCCACACGGAGTACTTG
Table 2.
Probiotics lysate HDB1234 and Lava-Dermabiotics HDB1234 purity analysis by nanodrop
Sample A230 A260 A280 A260/A280 A260/A230
Probiotics lysate HDB1234 51.18 8.70 7.17 1.21 0.17
Lava-Dermabiotics HDB1234 8.01 14.51 7.25 2.00 1.81

References

Bae, K. H., Kim, K. J., Kim, N. Y., & Song, J. M. (2012). In vitro culture of rare plant Bletilla striata using Jeju magma seawater. J. Plant Biotechnol, 39:281-287.
crossref
Bäsler, T., & Brandner, J. M. (2017). Tight junctions in skin inflammation. Pflugers Arch, 469:3-14.
crossref pmid
Bergmann, S., von Buenau, B., Vidal-y-Sy, S., Haftek, M., Wladykowski, E., Houdek, P., Lezius, S., Duplan, H., Bäsler, K., Dähnhardt-Pfeiffer, S., Gorzelanny, C., Schneider, S. W., Rodriguez, E., Stölzl, D., Weidinger, S., & Brandner, J. M. (2020). Claudin1 decrease impacts epidermal barrier function in atopic dermatitis lesions dose-dependently. Sci. Rep, 10(1), 2024.
crossref pmid pmc
Brown, S., Santa Maria, J. P., & Walker, S. (2013). Wall teichoic acids of gram-positive bacteria. Annu. Rev. Microbiol, 67:313-336.
crossref pmid
Chapot-Chartier, M., & Kulakauskas, S. (2014). Cell wall structure and function in lactic acid bacteria. Microb. Cell Fact, 13:S9.
crossref pmid pmc
Desjardins, P., & Conklin, D. (2010). Nanodrop microvolume quantitation of nucleic acids. J. Vis. Exp, 45:e2565.
crossref
Desvaux, M. I., Dumas, E., Chafsey, I., & Hebraud, M. (2006). Protein cell surface display in gram-positive bacteria: from single protein to macromolecular protein structure. FEMS Microbiol. Lett, 256:1-15.
crossref pmid
Dominguez-Bello, M. G., Costello, E. K., Contreras, M., Magris, M., Hidalgo, G., Fierer, N., & Knight, R. (2010). Delivery mode shapes the acquisition and structure of the initial microbiota across multiple body habitats in newborns. Proc. Nati. Acad. Sci. U. S. A, 107:11971-11975.
crossref
Dominguez-Bello, M. G., De Jesus-Laboy, K. M., Shen, N., Cox, L. M., Amir, A., Gonzalez, A., Bokulich, N. A., Song, S. J., Hoashi, M., Rivera-Vinas, J. I., Mendez, K., Knight, R., & Clemente, J. C. (2016). Partial restoration of the microbiota of cesarean-born infants via vaginal microbial transfer. Nat. Med, 22:250-254.
crossref pmid pmc
Günzel, D., & Yu, A. S. L. (2013). Claudins and the modulation of tight junction permeability. Physiol. Rev, 93(2), 525-569.
crossref pmid pmc
Hannigan, G. D., & Grice, E. A. (2013). Microbial ecology of the skin in the era of metagenomics and molecular microbiology. Cold Spring Harb. Perspect. Med, 3:a015362.
crossref pmid pmc
Heo, J., Lee, H. K., & Kim, Y. (2019). Development of health-promoting probiotics and microbiome for safety and functionality of animal foods. Food Sci. Anim. Resour, 8:27-34.
Hönzke, S., Wallmeyer, L., Ostrowski, A., Radbruch, M., Mundhenk, L., Schäfer-Korting, M., & Hedtrich, S. (2016). Influence of Th2 cytokines on the cornified envelope, tight junction proteins, and β-defensins in filaggrin-deficient skin equivalents. J. Invest. Dermatol, 136:631-639.
crossref pmid
Jeong, J. H., Lee, C. Y., & Chung, D. K. (2015 Probiotic lactic acid bacteria and skin health. Crit. Rev. Food Sci. Nutr, 56:2331-2337. doi: 10.1080/10408398.2013.834874.
crossref
Jung, S. H., Jeon, S., Young, M., Moon, Y. J., Hong, Y. E., & Kweon, M. (2017). Quality of cookies formulated with Jeju magma seawater. Korean J. Food Cook. Sci, 33:292-299.
crossref
Jung, Y. O., Jeong, H., Cho, Y., Lee, E. O., Jang, H. W., Kim, J., Nam, K. T., & Lim, K. M. (2019). Lysates of a probiotic, Lactobacillus rhamnosus, can improve skin barrier function in a reconstructed human epidermis model. Int. J. Mol. Sci, 20:4289.
crossref pmc
Kerry, R. G., Patra, J. K., Gouda, S., Park, Y., Shin, H. S., & Das, G. (2018). Benefaction of probiotics for human health: A review. J. Food Drug Anal, 26:927-939.
pmid
Khayyira, A. S., Rosdina, A. E., Irianti, M. I., & Malik, A. (2020). Simultaneous profiling and cultivation of the skin microbiome of healthy young adults skin for the development of therapeutic agents. Heliyon, 6:e03700.
crossref pmid pmc
Kim, B., & Kim, H. S. (2017). Antimicrobial activities and skin barrier improvement effect of Eruca sativa extract. Korean J. Food Preserv, 24:320-324.
crossref
Kim, H., Kim, H. R., Jeong, B. J., Lee, S. S., Kim, T. R., Jeong, J. H., Lee, M., Lee, S., Lee, J. S., & Chung, D. K. (2015). Effects of oral intake of kimchi-derived Lactobacillus plantarum K8 lysates on skin moisturizing. J. Microbiol. Biotechnol, 25:74-80.
crossref pmid
Kim, H., & Lee, S. H. (2008). The effect of skin surface on epidermal permeability barrier. J Skin Barrier Res, 10:44-55.
Kim, H. M., Lee, J. N., Kim, J. M., Kim, S. K., & Park, S. M. (2016). The effect of Jeju wild ginseng extracts on skin barrier via serine-palmitoyltransferase. J. Soc. Cosmet. Sci. Korea, 42(2), 119-126.
crossref
Kim, H., Shin, J. U., & Lee, K. H. (2013). Atopic dermatitis and skin barrier dysfunction. Allergy Asthma Respir. Dis, 1(1), 20-28.
crossref
Kim, J. K., Lee, J. H., Bae, I. H., Seo, D. B., & Lee, S. J. (2011). Beneficial effect of a collagen peptide supplement on the epidermal skin barrier. Korean J. Food Sci. Technol, 43:458-463.
crossref
Kim, K. M., Yang, S. J., Kim, D. S., Lee, C. W., Kim, H. Y., Lee, S., Choi, J. W., Sohn, J., Shin, S. S., & Lee, S. (2020). Probiotic properties and immune-stimulating effect of the Jeju lava seawater mineral-coated probiotics. LWT-Food Sci. Technol, 126:109299.
crossref
Kim, N. Y., Kim, T. B., & Lee, H. Y. (2015). Skin anti-aging activities of bacteriochlorophyll a from photosynthetic bacteria, Rhodobacter spaeroides. J. Microbiol. Biotechnol, 25(10), 1589-1598.
crossref pmid
Kim, N. Y., & Lee, H. Y. (2015). Enhancement of skin whitening and anti-wrinkle activities of the co-culture of Lactobacillus rhamnosus and Lactobacillus paracasei. J. Sco. Cosmet. Sci. Korea, 41(3), 253-261.
crossref
Kim, Y., Han, S. M., & Cho, Y. (2013). The dietary effect of royal jelly supplementation on epidermal levels of filaggrin and free amino acid during menopause in rats. J. Korean Soc. Food Sci. Nut, 42(3), 389-396.
crossref
Lee, S. H., Bea, I. H., Min, D. J., Kim, H. J., Park, N. H., Choi, J. H., Shin, J. S., Kim, E. J., & Lee, H. K. (2016). Skin hydration effect of Jeju lava sea water. J. Soc. Cosmet. Sci. Korea, 42:343-349.
crossref
Lee, S. H., Min, D. J., Na, Y. J., Shim, J., Kwon, L. K., Cho, J. C., & Lee, H. K. (2013). The Protective effect of mineral water against UVB irradiation. J. Soc. Cosmet. Sci. Korea, 39(1), 39-46.
crossref
Lee, S. S., Choi, S. K., Kim, J. W., Han, H. S., & Kim, K. K. (2019). Investigation of the effect of water extract from Cudrania tricuspidata fruit on tight junction in human keratinocyte. Kor. J. Herbology, 34(1), 99-107.
Lim, H. Y., Jeong, D., Park, S. H., Shjn, K. K., Hong, Y. H., Kim, E., Yu, Y. G., Kim, T. R., Kim, H., Lee, J., & Cho, J. Y. (2020). Antiwrinkle and antimelanogenesis effect of tyndallized Lactobacillus acidophilus KCCM12625P. Int. J. Mol. Sci, 21:1620.
crossref pmc
Nakatsuji, T., Chiang, H. I., Jiang, S. B., Nagarajan, H., Zengler, K., & Gallo, R. L. (2013). The microbiome extends to subepidermal compartments of normal skin. Nat. Commun, 4:1431.
crossref pmid pmc
Owczarzy, R., Moreira, B. G., You, Y., Behlke, M. A., & Walder, J. A. (2008). Predicting stability of DNA duplexes in solutions containing magnesium and monovalent cations. Biochemistry, 47:5336-5353.
crossref pmid
So, Y., Hwang, J. Y., Kim, H. W., Jo, H. N., & Lee, T. B. (2019). Skin hydration and skin barrier effects of Cymbopogon citratus and Perilla frutescens extracts. J. Soc. Cosmet. Sci. Korea, 45:225-235.
Wallmeyer, L., Dietert, K., Sochorová, M., Gruber, A. D., Kleuser, B., Vávrová, K., & Hedtrich, S. (2017). TSLP is a direct trigger for T cell migration in filaggrin-deficient skin equivalents. Sci. Rep, 7:774.
crossref pmid pmc
Yu, H. Y., Yang, I. J., Lincha, V. R., Park, I. S., Lee, D. U., & Shin, H. M. (2015). The effects of the fruits of Foeniculum vulgare on skin barrier function and hyaluronic acid production in HaCaT keratinocytes. J. Life Sci, 25(8), 880-888.
crossref
TOOLS
METRICS Graph View
  • 0 Crossref
  •  0 Scopus
  • 699 View
  • 23 Download
Related articles


ABOUT
BROWSE ARTICLES
EDITORIAL POLICY
FOR CONTRIBUTORS
Editorial Office
95 Hoamro, Uijeongbu-city, Gyeonggi-do 11644, Korea
Tel: +82-10-2825-6735        E-mail: beauty2007@hanmail.net                

Copyright © 2021 by Korean Society of Cosmetology.

Developed in M2PI

Close layer
prev next