괄루근의 항알러지 및 피부염증에 미치는 영향

Effect of Trichosanthis Radix Extract on Anti-allergy and Skin Inflammation

Article information

J Korean Soc Cosmetol. 2024;30(5):1035-1041

Publication date (electronic) : 2024 October 31

doi : https://doi.org/10.52660/JKSC.2024.30.5.1035

Won-Jin Baek ¹, Mi-Young Yun ²^,

¹Professor, Department of Beauty Science, Kwangju Woman University

²Professor, Department of Beauty Art, Youngsan University

백원진¹, 윤미영²^,

¹광주여자대학교 미용과학과, 교수

²영산대학교 미용예술학과, 교수

^*Corresponding author: Mi-Young Yun Tel : +82-62-950-3853 E-mail : beauty@kwu.ac.kr

Received 2024 August 8; Revised 2024 August 28; Accepted 2024 September 7.

Trans Abstract

This study was conducted to study the effects of TR-W and TR-E on anti-allergy and skin inflammation inhibition. In order to check the concentration used in the experiment and its toxicity to cells, RBL-2H3 cells and HMC-1 cells were treated with TR-W and TR-E at different concentrations and tested at a concentration of 100 mg/ml or less, which does not affect the survival rate. proceeded. In order to determine the effect on the inflammatory response to mast cells, the inflammatory cytokines TNF-α, IL-8, and IL-6 were measured. As a result, TR-W and TR were found in TNF-α and IL-8, which promote the early inflammatory response. -E showed a significant effect at 100 mg/ml, and TR-E showed a significant effect at 50 mg/ml, showing the effect even at a lower concentration than TR-W. IL-6, which is involved in causing allergic dermatitis, showed a significant effect at 100 and 50 mg/ml in TR-W and TRE, indicating that it is effective in suppressing inflammation in TR-W and TR-E. In addition, histamine and β-hexosaminidase, which are inflammatory mediators involved in the initial allergic reaction, were significantly suppressed at 100 and 50 mg/ml in TR-W and TR-E, demonstrating anti-allergy effect. These research results are believed to have the highest utility value as a functional cosmetic material in the future, and additional research is considered necessary.

Keywords: Anti-allergy; Skin inflammation; Trichosanthis radix

I. 서 론

피부는 사람의 첫인상을 좌우하며 피부건강이 행복감에 영향을 미치는 것으로 알려져 있다(Yoon & Kim, 2010). 이러한 때에 환경오염과 함께 선진국의 알레르기 질환은 지속적으로 증가하고 있으며, 특히 아토피피부염, 알레르기 비염, 천식, 음식 알레르기로 치료받고 있는 인구는 점차 늘어나고 있다(Aguilera et al., 2020). 알레르기 질환의 치료는 항히스타민제, 소염제, 스테로이드 요법으로 1차적 치료로 적용하고 있지만 대증치료라는 한계점이 있고, 다양한 부작용으로 극히 제한적으로 치료에 적용하고 있다(Gupta & Chow, 2004).

피부는 표피(epidermis), 진피(dermis), 피하지방층(subcutaneous)으로 구분되어 있으며(Kim, 2009), 표피는 외부환경부터 피부를 보호하는 장벽기능, 자외선 방어 기능, 면역반응과 염증반응에 관여하고 있다(Jo et al., 2017). 알러지 반응은 무해한 물질에 면역체계가 반응하여 항원으로 인식, 과민반응, 오작동으로 재채기, 눈물, 가려움, 피부발진 등을 유발하는 것을 총칭하고 있으며, 아나필락시스(anaphylaxis) 같은 경우 심한 경우 호흡곤란, 급성저혈압 및 쇼크 등 생명에 위험한 증상을 일으킬 수 있다(Bilo & Bonifazi, 2008).

대표적인 알러지성 피부염은 아토피 피부염으로 환경변화에 영향을 많이 받으면서, 큰폭으로 증가하고 있는게 현실이다(Kiczuk et al., 2004). 아토피 피부염은 가려움증을 동반한 만성 염증성 질환으로, 천식, 알러지성 결막염, 알레르기성 비염과 같은 아토피 소인(atopic tendency)을 가진 사람에게 유병율과 가족력을 나타낸다(Foroughi et al., 2005).

아토피 피부염은 유소아의 경우 15~20% 정도에서 발병율을 보이고, 성인의 경우에는 1~2% 정도에 감소하여 유소년기에 특징적으로 많은 발병율을 나타낸다(Nakahara & Furue, 2005). 아토피 피부염, 접촉성 피부염 등과 같은 알레르기성 피부염시에는 특징적으로 심한 가려움증을 동반하여 이로인하여 염증을 악화시켜, 피부염증으로 발전시킨다(Lorette & Vaillant, 1990), 이들 알레르기성 피부염 치료는 염증 치료와 함께 가려움증 완화가 필수적인 것으로 알려져 있다(Ishiguro et al., 2002).

이에 괄루근(Trichosanthes Kirilowii)은 하늘타리의 뿌리로, 민간요법에서 항염증, 기침, 천식, 해열, 중풍 등 알러지와 관련된 질환에도 사용되었으며(Moon, 1999; Lim & Choi, 1997; Chung & Lee, 1995; Koh & Kim, 1977), 비만과 면역활성에 대한 연구도 진행되어져 있다(Kwon et al., 1993). 한방에서는 열매와 뿌리를 해열, 해수, 이뇨, 변비, 어혈, 황달, 피부병, 결핵, 유방염, 적백리, 당뇨병 등의 다양한 치료에 사용하고 있어(Zhu, 1998), 이를 활용하여 HMC-1(Human Mast Cell)로 염증 cytokine IL-8, IL-6, TNF-α에 미치는 영향을 확인하고, 가려움증에 관여하는 염증매개물질이 Histamin과 β-Hexosaminidase를 확인하여 알러지에 의한 피부염증에 대한 효능을 입증하고자 한다.

II. 재료 및 방법

1. 약재

괄루근(Tricosanthis Radix: TR)은 옴니허브(korean)에서 구입하였다. 초음파 세척기(Branson, U.S.A.)를 이용하여 약재로 불순물을 제거하여 사용하였다. 약재 1.2 kg를 열탕기를 이용하여 4시간씩 3회 추출하였다. 약물은 여과와 감압농축기로 농축하여 105.26g으로 8.77%를 얻었다(TR-W). 60% 주정으로 4시간씩 3회 추출하여 여과와 감압농축기로 농축하여 99.71g으로 8.31%를 얻었다(TR-E).

2. RBL-2H3, HMC-1 cell 배양

RBL-2H3(Rat basophil leukemian cell line), HMC (Human mast cell line) 세포를 5 × 10⁵/ml로 세포를 측정하여 DMEM, antibiotics와 10% FBS를 넣고, 37℃ CO₂ 배양기에서 3일간 배양하여 실험에 사용하였다.

3. 시약 및 기기

본 실험에 사용된 시약은 trypsin-0.2% EDTA, DMEM, D-PBS, EtOH 등은 Sigma 사(U.S.A) 제품을 사용하였다. Taq polymerase와 Deoxynucleotide triphosphate (dNTP) (TaKaRa co., Japan), M-MLV RT(Moloey Murine Leukemia Virus Reverse Transcriptase)와 CsA (cyclosporin A)는 중외제약, MTT (3-(4,5dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide), RNase inhibitor(Promega. Madison, U.S.A), FBS(Hyclone. Logan, U.S.A), DMED(Gibco. Gaithersburg, MD, U.S.A), RNase(Pharmingen. Torreyana, U.S.A), DNP IgE (Sigma-Aldrich), DNP-BSA(Alpha Diagnostic International, San Antonio, TX, USA), 인간 재조합 IL-6, IL-8, TNF-α, histamin kit(R & D system. U.S.A.) 제품을 사용하였으며, 기타 시약은 특급 시약을 사용하였다.

기기는 열탕추출기(대웅, Korea), Microwave oven (LG, Korea), Rotary vaccum evaporator, Freeze dryer (EYELA FDU-540, Co., Japan), CO₂ Incubator (Forma scientific Co., U.S.A.), Autoclave (Sanyo, Co., Japan), Micro-pipet (Gilson, Co., France), Water bath (Vision scientific Co., Korea), Spectrophotometer (Shimazue, Co., Japan), Centrifuge (Sigma, Co., U.S.A.), ELISA reader (Molecular Devices, Co., U.S.A.), 7500 Fast Real-Time PCR system (Applied Biosystems, Co., U.S.A.), Flow cytometer (Becton Dickinson, U.S.A) 등을 실험에 사용하였다.

4. 실험방법

1) 세포독성 측정

세포독성 측정은 MTT assay법을 약간 변형하여 사용하였다. RBL-2H3, HMC-1 cell 세포를 37℃, 5% CO₂ 배양기에서 배양한 후 Trysin-EDTA 용액으로 단일 세포로 분리하여 1 × 10⁴ 세포로 96 well plate에 분주한 후 CO₂ 배양기에서 배양하였다. TR-W와 TR-E를 각각 10, 25, 50, 100, 200 ㎍/㎖를 24시간 처리하였다. 실험 종료 후에 배양액을 버리고 PBS로 2회 세척하고, MTT solution(5 ㎍/㎖)를 4시간 동안 37℃에 방치하였다. DMEM에 MTT 용액을 가하고 37℃에서 4시간 배양하여 MTT를 환원시켜 생성된 formazan을 배지에서 제거한 다음 암조건에서 30분 건조 후 DMSO을 넣고 1시간 동안 MIX한 후 흡광도를 560 nm에서 측정하였다.

2) Real Time Quantitative RT-PCR

- RNA 추출

HMC-1세포를 24 well plate에 5 × 10⁴ 세포로 각 well에 분주하고, TR-W와 TR-E를 200, 100, 25 ㎍/㎖, 양성대조군 CsA(10 ㎍/㎖)를 처리하였다. 1시간 후 PMA(50 ng/㎖)와 A23187(0.5 μΜ)을 well에 첨가하여 24시간동안 배양하고, 5분간 2,000 rpm에서 원심분리하였다. 원심분리 후 상층액을 제거하고, 여기에 500 ml RNAzolB를 넣고 혼합하였다. 혼합한 부유액에 50 ㎕ chloroform을 혼합하였다. 부유액을 ice에 15 분간 배양한 후 13,000 rpm에서 원심분리를 하고 상층액 200 ㎕를 2-propanol 200 ㎕와 동량 Mix 후 ice에서 15 분간 두었다. 13,000 rpm에서 원심 분리한 후 80% 에탕올로 세척하고 vaccum pump에서 3분간 건조하여 RNA를 추출하였다. 추출한 RNA를 diethyl pyrocarbonate (DEPC)로 처리하고 20 ml의 D.W에 녹여 heating block 75℃에서 불활성화 시킨 후 first strand cDNA 합성에 사용하였다.

- 역전사-중합효소 연쇄반응

총 RNA 3 ㎍을 DNase I를 10 U/㎕를 2U/tube에 넣어 37℃ heating block에서 30분간 반응하고 75℃에서 10분 동안 변성시킨다. 여기에 2.5 ㎕ 10 mM dNTPs를 mix하고, 1 ㎕ random sequence hexanucleotides를 25 pmole/25 ㎕로 넣고, RNA inhibitor로서 1 ㎕ RNase inhibitor 20 U/㎕와 1 ㎕ 100 mM DTT를 4.5 ㎕ 5×RT buffer에 Mix후, 1 ㎕의 M-MLV RT를 200 U/㎕로 EPC 처리된 증류수로서 최종 부피가 20 ㎕가 되도록 역전사 반응을 준비하였다.

반응액 20 ㎕를 혼합한 후 2,000 rpm에서 5초간 원심 분리하여 37℃ heating block에서 60분간 반응시켜 first-strand cDNA를 합성하였다. M-MLV RT를 95℃에서 5분 동안 방치하여 불활성화시킨 후 cDNA를 polymerase chain reaction (PCR)에 사용하였다.

3) Real Time Quantitative RT-PCR

HMC-1으로부터의 total RNA는 TRI 시약으로 분리하였다. 염색체의 DNA을 제거하기 위해 DNase I (Life Technologies, Grand Island, NY)로 digested 하였다. 75℃에서 20분 동안 DNase과 5 ㎍을 넣어 혼합하고 total 총 RAN은 First Strand cDNA Synthesis kit (Amersham Pharmacia, Piscataway, NJ)로 cDNA으로 전사하였다.

다음의 방법으로 Real-Time PCR은 Applied (Applied Biosystems, U.S.A)로 수행하였다. 라벨을 probes는 6-carboxyfluorescein로 붙이고, 모든 cDNA과 같은 양을 포함한 beta-actin cDNA는 각 cDAN 표본을 AmpliTaq Gold DNA Polymerase을 포함시켜 TaqMan Universal PCR로 증폭시켰다.

PCR 조건은 40 cycles로 50℃에서 2분, 95℃과 10분, 60℃에서 15초 진행하였다. 사용된 probe는 다음과 같다.

4) Histamine 분비량 측정

24 well plate에 HMC-1 세포를 5 × 10⁴로 각 well에 분주하고, 여기에 TR-W와 TR-E 100, 500, 25 ㎍/㎖, 양성대조군으로 CsA 10 ㎍/㎖를 처리하고 1시간 배양한 다음 PMA(50 ng/㎖)와 A23187 (0.5 μΜ)를 well에 첨가하여, 24시간에 배양한 후, anti-IgE를 coating 완충용액에 희석하여 4℃에서 30분 microwell에 coating하고 방치한 후, ELISA leader 450 nm에서 흡광도를 측정하였다.

5) β-Hexosaminidase 분비량 측정

RBL-2H3 cell을 2 × 10⁵ cell/㎖로 48 well plate에 18시간 배양한 후 tyroid buffer로 세포를 세척하고, 배양액으로 교체하였다. Dinitrophenyl-ImmunoglobulinE (DNP IgE: 20 ng/㎖)로 자극하고 37℃ 5% CO₂ 배양기에서 24시간 배양하였다. 각 세포들을 Siraganian buffer로 2번 세척한 다음 37℃ 5% CO₂ 배양기에서 10분간 반응시킨 후 TR-W와 TR-E를 200, 100, 25 ㎍/㎖로 처리한 후 30분 동안 반응시켰다. 반응을 마치고 항원 2 µg/mL DNP-HSA(Sigma, USA)을 넣어 10분 반응시키고서 5분간 ice bath에 반응을 마무리하였다. 상층액 40 ㎕에 substrate buffer 40 ㎕를 1:1로 넣고 37℃에서 1시간 배양시킨 다음 각 well당 stop solution 200 ㎕를 넣어 반응을 마치고 Microplate reader 405 ㎚에서 흡광도를 측정하였다.

5. 통계처리

다양한 실험으로부터 얻은 결과는 mean ± standard error로 기록하였고, 유의성 검증은 Student’s T-test 분석법을 이용하여 결정하였다.

III. 결과 및 고찰

1. 세포독성

RBL-2H3와 HMC-1에 TR-W와 TR-E의 세포독성을 확인한 결과, RBL-2H3에서 시료를 처리하지 않은 군은 100.0 ± 5.20를 나타내었고, TR-W에서 10, 25, 50, 100, 200 ㎍/㎖의 농도별로 처리한 결과 98.43 ± 0.35, 95.98 ± 0.36, 93.39 ± 0.15, 90.51 ± 0.33, 85.12 ± 0.60으로 나타내었으며, TR-E에서 97.54 ± 1.25, 93.47 ± 2.14, 91.24 ± 0.21, 90.12 ± 3.41, 87.24 ± 3.61으로 나타내어 100 ㎍/㎖ 이하에서는 독성을 나타내지 않아 실험에 적용하였다.

HMC-1에서 시료를 처리하지 않은 군은 100.0 ± 3.21를 나타내었고, TR-W에서 10, 25, 50, 100, 200 ㎍/㎖의 농도별로 처리한 결과 99.7 ± 1.35, 98.21 ± 2.15, 95.28 ± 1.17, 92.5 ± 3.12, 89.02 ± 6.12으로 나타내었으며, TR-E에서 97.54 ± 1.25, 93.47 ± 2.14, 91.24 ± 0.21, 90.12 ± 3.41, 87.24 ± 3.61으로 나타내어 100 ㎍/㎖ 이하에서는 독성을 나타내지 않아 실험에 적용하였다(Fig. 1).

Fig. 1.

Cytotoxicity of TR-W and TR-E on the RBL-2H3 & HMC-1 cells. The results are presented as the mean ± S.D. of three independent experiments. Cell cytotoxicity was evaluated with the MTT assay. Mean values ± S.D. from triplicate separated experiments are shown.

2. 염증 사이토카인 발현에 미치는 영향

비만세포의 활성화와 염증반응은 염증성 사이토카인에 의해 조절된다(Dinarell et al., 1990). 염증 사이토카인 TNF-α와 IL-8은 알러지 천식, 아토피 피부염등 알러지성 질환의 초기 염증 반응을 촉진하여 강력한 염증 반응을 유도하는 것으로 알려져 있으며(Salamon et al., 2005; Harada et al., 1994; Marini et al., 1992), 특히, TNF-α는 대식세포에서 생성되어 면역반응을 증가시키고, 혈관 성장 자극과 염증을 억제하지만(Nedwin et al., 1985; Lee, 2023), 다량의 경우 오히려 대사의 손상과 염증을 유발한다(Beutler & Cerami, 1989). IL-6는 다양한 염증세포에서 분비되는 사이토카인으로 천식이나 아토피 피부염등 알러지성 질환에서 염증반응을 주도하는 것으로 알려져 있다(Kristiana et al., 2006; O’Hara et al., 2003). 이에 비만세포주 HMC-1에 PMA 와 A23187을 처리하여 세포를 활성화시킨 후 TR-W와 TR-E를 100, 50, 25 ㎍/㎖로 처리하여 mRNA 유전자 발현을 진행하고 Real-Time PCR을 통해 염증 사이토카인 발현량을 측정하였다. 초기염증을 담당하는 IL-8에서는 TR-W에서 100, 50 ㎍/㎖, TR-E에서 100, 50 ㎍/㎖에서 유의성 있는 감소효과를 나타내었다. TNF-α에서는 TR-W에서 100 ㎍/㎖, TR-E에서 100, 50 ㎍/㎖ 농도에서 유의성 있는 감소효과를 나타내었다. IL-6에서는 TR-W에서 100, 50 ㎍/㎖, TR-E에서 100, 50 ㎍/㎖에서 유의성 있는 감소효과를 나타내었다. 특히 IL-6는 염증 초기반응에 관여하고 조직의 손상과 발열에 관여하는 것으로 알려져 있는데(Liu et al., 1998), 이를 농도 의존적으로 억제하여 알러지로 인한 피부염증에 감소에 영향을 주는 것으로 차후에 여드름 관련 화장품 소재 활용이 요구된다(Fig. 2).

Fig. 2.

Inhibitory effects of TR-W and TR-E on IL-6, IL-8 and TNF-α mRNA expression in PMA/A23187-stimulated HMC-1. Human mast cell line were stimulated with PMA and A23187 and cultured in the presence of TR-W and TR-E (100, 50, 25 ㎍/㎖) or cyclosporin A (10 ㎍/㎖) for 6 h. The relative levels of IL-6, IL-8 and TNF-α mRNA expression compared with control were determined by quantitative real-time PCR.

3. Histamine 분비량에 미치는 영향

비만세포에 의해 분비된 histamine은 알러지 초기 반응의 탈과립을 나타내는 주요 인자이고(Park et al., 1981), 후기반응은 수시간 내에 발생하여 Th2 사이토카인을 합성하고 분비하여 염증반응을 지속시킨다(Church, 1997). 비만세포는 세포막표면에 수많은 IgE 수용체를 발현하고 있어 항체에 감작된 후 항원에 반응하여 histamine을 분비한다(Chang & Shiung, 2006). 이에 비만세포주 HMC-1에 PMA와 A23187을 처리하여 세포를 활성화시킨 후 TR-W와 TR-E를 100, 50, 25 ㎍/㎖로 처리하여 활성을 확인한 결과, 대조군에 비하여 TR-W는 100 ㎍/㎖에서 TR-E는 100, 50 ㎍/㎖에서는 유의성 있는 감소효과를 나타내였다. TR-W, TR-E의 염증세포의 억제와 소양증 감소는 소양증으로 인한 알러지 질환의 2차 감염을 유발을 억제하는 것으로 피부염증치료에 중요한 척도가 된다(Fig. 3).

Fig. 3.

Effect of TR-W and TR-E on histamine release in HMC-1. Human mast cells were stimulated with PMA (50 ng/㎖) and A23187 (0.5 μΜ), and cultured in the presence of TR-W and TR-E (100, 50, 25 ㎍/㎖) or cyclosporin A (10 ㎍/㎖) for 6 h. The levels of histamine in the supernatant were determined by ELISA assay.

4. β-Hexosaminidase 분비량에 미치는 영향

β-Hexosaminidase는 비만세포에 저장되어 있다가 특정 항원에 의해 활성화되면 탈과립 현상을 나타내면서 염증성 매개 물질을 분비한다(Mastuda et al., 2002). RBL-2H3 세포는 비만세포의 특징을 가지고 있으며 세포막표면에 IgE 수용체를 발현하고 있다가(Marquardt &Wasserman, 1983), IgE에 감작된 후 β-hexosaminidase를 분비하는 특성을 가지고 있어(Park, 2011), 탈과립 지표와 항알러지 효과를 측정하는데 이용된다. 염증매개 물질은 혈관확장, 가려움, 혈장의 삼출등으로 부종을 유발하는 것으로 알려져 있다(Chang & Shiung, 2006). 비만세포주 RBL-2H3 세포에 DNP-IgE(+)로 활성화시킨 후 효능을 알아보기 위해 TR-W와 TR-E의 100, 50, 25 ㎍/㎖로 측정한 결과, 대조군에 비하여 양성대조군인 quercetin은 32% 감소를 나타내었고, TR-W와 TR-E에서 각각 100 ㎍/㎖ 농도에서는 18.2%, 21%의 유의성 있는 감소효과를 나타내어 염증매개 물질의 억제를 나타내었다. 이러한 연구결과는 염증으로 인한 부종억제와 소양증 감소에 영향을 미치므로 화장품 소재에 적극적인 활용이 용이할 것으로 사료된다(Fig. 4).

Fig. 4.

Ability of TR-W and TR-E to inhibit β-hexosaminidase release of IgE- antigen complex-stimulated RBL-2H3 cells. Each values represents mean ± S.D. of three individual experiments.

IV. 결 론

본 연구는 TR-W와 TR-E이 항알러지 및 피부염증 억제에 미치는 영향에 대하여 연구를 진행하였다. 실험에 사용되는 농도와 세포의 독성을 확인하기 위해 RBL-2H3 세포와 HMC-1 세포에서 TR-W와 TR-E를 농도별로 처리하여 생존율에 영향을 미치지 않는 100 ㎍/㎖ 이하의 농도로 실험을 진행하였다.

비만세포에 대한 염증반응에 영향을 알아보기 위해서 염증 사이토카인 TNF-α, IL-8와 IL-6를 측정한 결과, 초기 염증 반응을 촉진하는 TNF-α, IL-8에서 TR-W와 TR-E에서 100 ㎍/㎖에서 유의성 있는 효과를 나타내었고, TR-E에서는 50 ㎍/㎖에서도 유의성 있는 효과를 나타내어 TR-W보다 낮은 농도에서도 효과를 나타내었다. 알러지 피부염을 유발에 관여하는 IL-6는 TR-W와 TR-E에서 100, 50 ㎍/㎖에서 유의성 있는 효과를 나타내어 TR-W과 TR-E의 염증억제에 효과적임을 나타내었다. 또한 알러지 초기반응에 관여하는 염증 매개인자로 Histamine, β-Hexosaminidase는 TR-W와 TR-E에서 100, 50 ㎍/㎖에서 유의성 있는 억제를 나타내어 항알러지 효과를 입증하였다. 이러한 연구결과는 세포실험을 진행한것에 한계로 임상실험과 결과가 다를수 있음에 한계가 있다. 하지만 이러한 연구를 토대로 향후 기능성 화장품소재로써 활용가치가 가장 높을 것으로 판단하고 추가 연구가 필요하다 여겨진다.

References

1. Aguilera A. C., Dagher I. A., Kloepfer K. M.. 2020;Role of the Microbiome in Allergic Disease Developm ent. Curr Allergy Asthma Rep 20(9):44.

2. Beutler B., Cerami A.. 1989;The biology of cachectin/TNF-α primary mediator of the host response. Annu. Rev. Immunol 7:625–655.

3. Bilo B. M., Bonifazi F.. 2008;Epidemiology of insect-venom anaphylaxis. Curr. Opin. Allergy Clin. Immunol 8:330–337.

4. Chang T. W., Shiung Y. Y.. 2006;Anti-IgE as a mast cell– stabilizing therapeutic agent. The Journal of Allergy and Immunology 117(6):1203–1212.

5. Chung Y. B., Lee C. C.. 1995;Effect of polysaccharide from Trichosanthes kirilowii on antidiabetic activity and glutathione metabolism in hyperglycemic rats. Yakhak Hoeji 39(5):528–534.

6. Church M. K., Levi-Schaffer F.. 1997;The human mast cell. J. Allergy Clin. Imm 99:155–160.

7. Dinarello C. A., Endres S., Meydani S. N., Meydani M., Hellerstein M. K.. 1990;Interleukin-1, anorexia, and dietary fatty acids. Ann. N Y Acad. Sci 587:33.

8. Foroughi S., Thyagarajan A., Stone K. D.. 2005;Advances in pediatric asthma and atopic dermatitis. Curr. Opin. Pediatr 17(5):658–63.

9. Gupta A. K., Chow M.. 2004;Prednicarbate (Dermatop): profile of a corticosteroid. J. Cutan Med. Surg 8:244–247.

10. Harada A., Seikido N., Akahoshi T., Mukaida N., Matsushima K.. 1994;Essential involvement of interleukin-8 in acute inflammation. J. Leukoc. Biol 56:559–564.

11. Hwang M. S., Pyo J., Kim H. J., Do S. G., Song I. D., Kim K. M.. 2022;Anti-inflammatory and Anti-allergic Effects of Lentinula edodes Extract by UV Irradiation. Journal of Life Science 32(5):368–374.

12. Ishiguro K., Oku H., Suitani A., Yamamoto Y.. 2002;Effects of conjugated linoleic acid on anaphylaxis and allergic pruritus. Biol. Pharm. Bull 25:1655–1657.

13. Jo I.-J., Kim M.-S., Kim K. Y.. 2017;Anti-inflammatory Effect of Nardostachys jatamansi on TNF-alpha-induced Inflammatory Response in HaCaT Cells. The Korean Society for Trichologists) 30(4):321–329.

14. Kiczuk K., Chodorowska G., Krasowska D.. 2004;The care of the child with atopic dermatitis. Ann. Univ. Mariae Curie Sklodowska 59:503–507.

15. Koh J. S., Kim H. O.. 1977;A study on the physicochemical properties of Trichosanthes kirilowii Max. starch. J. Korea Agric. Chem. Soc 20(3):292–295.

16. Kristiana K. G., Duraisamy K., Jing C., Curtis L., Theoharis C. T.. 2006;Regulation of IL-1-induced selective IL-6 release from human mast cells and inhibition by quercetin. Br. J. Pharmacol 148:208–215.

17. Kwon D.-H., Rheu B.-H., Kim H.-S., Kim K.-S., Yi S.-Y., Park J.-O.. 1993;Effects of Trichosanthis Radix Lectin on Cell Agglutination and Immune Function. Journal of Life Science 26(6):503–510.

18. Lee S.-E.. 2023;Antioxidative and Anti-inflammatory Effects of Daehwangmokdanphee-tang. J. Korean Soc. Cosmetol 29(5):1190–1198.

19. Lim S. J., Choi S. S.. 1997. The effect of Trichosanthes Kirilowii Max. subfractions on the insulin activity in streptozotocin induced diabetic rats and their acute toxicity.

20. Liu M., Li J., Kong F., Lin J., Gao Y.. 1998;Induction of immunomodulating cytokines by a new polysaccharide-peptide complex from culture mycelia of Lentinus edodes. Immunopharmacology 40:187–198.

21. Lorette G., Vaillant L.. 1990;Pruritus; current concepts in pathogenesis and treatment. Drugs 39:218–223.

22. Marini M., Vittori E., Hollemborg J., Mattoli S.. 1992;Expression of the potent inflammatory cytokines, granulocyte-macrophage-colonystimulating factor and interleukin-6 and interleukin-8 in bronchial epithelial cells of patients with asthma. J. Allergy Clin. Immunol 89:1001.

23. Marquardt D. L., Wasserman S. I.. 1983;Modulation of rat serosal mast cell biochemistry by in vivo dexamethasone administration. Immunol 131:934–9.

24. Mastuda H., Morikawa T., Ueda K., Managi H., Yoshikawa M.. 2002;Structural requirements of flavonoids for inhibition of antigen- Induced degranulation, TNF-alpha and IL-4 production from RBL-2H3 cells. Bioorg. Med. Chem 10(10):3123–3128.

25. Moon K. S.. 1999. The Composition of Korean Herb and Utilization Ilweulseogak. Seoul, Korea: p. 584–585.

26. Nakahara T., Furue M.. 2005;Mechanism of pathogenesis in atopic dermatitis. Nippon Rinsho 63:80–85.

27. Nedwin G. E., Svedersky L. P., Bringman T. S., Palladino M. A. Jr, Goeddel D. V.. 1985;Effect of interleukin 2, interferon-gamma, and mitogens on the production of tumor necrosis factors alpha and beta. J. Immunol 135:2492–2497.

28. O’Hara K. A., Kedda M. A., Thompson P. J., Knight D. A., Oncostatin M.. 2003;An interleukin-6-like cytokine relevant to airway remodelling and the pathogenesis of asthma. Clin. Exp. Allergy 33(8):1026–1032.

29. Park S. B.. 1981;Dissertation, Dong-eui Univ., Busan, Korea(2011). Metcalfe DD, Kaliner M, Donlon MA. The mast cell. Crit. Rev. Immunol 3:23–74.

30. Salamon D., Shoham N. G., Gavrieli R., Wolach B., Mekori Y. A.. 2005;Human mast cells release IL-8 and induced neutrophil chemotaxis on contact with activated T cells. Allergy 60:1316–1319.

31. Yoon C., Kim J.. 2010;The Effect of Middle and Elderly Woman’s Skin Care on Happiness. Asian J Beauty Cosmetol 8(4):383–396.

32. Zhu Y. P.. 1998. In Chines Materia Medicine Harwood Academic Publishers. Beijing, China: p. 489–490.

Article information Continued

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

human interleukin-6	AGCCCTGAGAAAGAGACATGTAACAAGAGTAACA
human interleukin 8	AGAGCTCTGTCTGGACCCCAAGGAAAAC
human TNF-αlpha	TGGCCCCAGGCAGTCAGATCATC
human glyceraldehyde-3-phosphatede hydrogenase (G3PDH)	CAAGCTTCCCGTTCTCAGCC