Anti-allergic Effect of Herbal Complex Extract on HMC-1 Mast Cells

Eun-Jin Lee; Mi-Young Yun

doi:10.52660/JKSC.2025.31.2.301

J Korean Soc Cosmetol > Volume 31(2); 2025 > Article

HMC-1 비만세포에 대한 생약 복합 추출물의 항알러지 효과

Research Paper

Journal of the Korean Society of Cosmetology 2025;31(2):301-306.

Published online: April 30, 2025

DOI: https://doi.org/10.52660/JKSC.2025.31.2.301

HMC-1 비만세포에 대한 생약 복합 추출물의 항알러지 효과

이은진¹, 윤미영^2,^*

¹영산대학교 미용예술학과, 겸임교수

²광주여자대학교 미용과학과, 교수

Anti-allergic Effect of Herbal Complex Extract on HMC-1 Mast Cells

Eun-Jin Lee¹, Mi-Young Yun^2,^*

¹Adjunct Professor, Department of Beauty Art, Youngsan University

²Professor, Department of Beauty Science, Kwangju Woman University

^*Corresponding author: Mi-Young Yun Tel : +82-10-8811-8323 E-mail : beauty@kwu.ac.kr

Received February 1, 2025 Revised March 10, 2025 Accepted March 17, 2025

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

This study examined the effects of S-W and S-E on allergy suppression and reached the following conclusions. In order to conduct an experiment on the anti-inflammatory effect, cytotoxicity was tested on the Human mast cell line (HMC-1). As a result, it was decided to apply the test at a concentration of 200 ㎍/㎖ or less, which does not show toxicity of S-W and S-E. As a result of amplifying the genes of cytokines IL-6, IL-8, and TNF-α, which act on inflammation, by Real Time Quantitative RT-PCR at a concentration of 200 ㎍/㎖ or less, a significant effect was shown at a concentration of 100 ㎍/㎖, IL-6 showed a significant inhibitory effect even at S-E of 100 ㎍/㎖. This showed the same results as similar herbal medicine experiments, proving that it is an effective material for inflammation that causes allergies. Histamine, which plays an important role in allergic reactions, is a substance that causes itching and is produced in mast cells. Accordingly, as a result of confirming the inhibition of histamine in HMC-1, it showed a significant inhibitory effect even at 100 ㎍/㎖ of S-W and S-E, proving that it is an effective material for alleviating itching among inflammatory skin diseases. Therefore, the results of this study confirmed the suppression of inflammation caused by stimulation of PMA and A23187 in HMC-1 of S-W and S-E, and the suppression of histamine by stimulation of compound 48/80, which can be used to suppress skin inflammation and itching caused by allergies in the future. It is believed that it is worth actively utilizing it and conducting various studies in materials research.

Keywords: Anti-allergic; Herbal medicine; Histamine; Human mast cell(HMC-1); Inflammation

I. 서 론

알러지 반응은 면역계가 특정 항원에 대해 과민 반응을 일으키는 질환으로, 주로 IgE 매개 면역 반응과 비만세포(mast cell)의 활성화에 의해 진행된다(Galli et al., 2008). 비만세포는 알러지 반응의 주요 매개 세포로 히스타민, IL-6, IL-8, TNF-α 등의 염증성 매개물질을 방출하여 염증과 면역 반응을 유도한다(Metz et al., 2007). 이러한 사이토카인과 히스타민은 천식, 알러지성 비염, 아토피 피부염 등과 같은 알러지 질환의 발병 및 증상 악화에 중요한 역할을 한다(Stone et al., 2010). 따라서 비만세포의 활성을 조절하고 염증 매개물질의 분비를 억제하는 것은 알러지 질환의 예방 및 치료에 있어 매우 중요하다(Kim et al., 2018).

천연물은 항염증 및 항알러지 효과를 가진 생리활성 물질은 인체에 부작용을 줄이며 완화시키는 것으로 주목받고 있다(Lee et al., 2020). 복합생약 추출물이란, 전통문헌을 바탕으로 전해져 내려오는 천연물을 소재로 사용하는 것을 말한다(Chan et al., 2008). 중국 의학서 “외대비요”에서 인용된 7가지(백지, 백렴, 백출, 백복령, 백급, 백부자, 백세신) 복합생약은 피부건강을 유지하는데 효과적인 것으로 고대문헌에 나와 있으며, 현재, 백지, 백렴, 백출, 백복령, 백급, 백부자, 백세신의 약물에 대한 효능은 이미 입증되어져 있으며. 이를 기반으로 물 추출물(S-W)과 에탄올 추출물(S-E)을 이용하여 실험에 적용하고자 한다. 일반적으로 에탄올은 용매가 남아 있어도 인체에 무해하기에 이를 적용하기로 하였다.

본 연구에서는 인간 비만세포인 Human Mast Cell Line을 활용하여 S-W 와 S-E의 사이토카인 IL-8, IL-6, TNF-α, 및 히스타민 분비에 미치는 억제 효과를 평가하였다. IL-6 및 IL-8은 비만세포에서 분비되는 대표적인 염증성 사이토카인으로, 주변 조직으로의 염증 세포 유입을 촉진하며(Moo et al., 2014), TNF-α는 알러지 반응의 초기 단계에서 염증 반응을 증폭시키는 중요한 역할을 한다(Batchelor et al., 2019). 또한, 히스타민은 비만세포의 탈과립 과정에서 방출되는 가장 잘 알려진 매개물질로, 혈관 확장, 혈관 투과성 증가, 가려움증 등을 유발하며 급성 알러지 반응의 주요 증상을 나타낸다(Subramanian et al., 2016). 이에, S-W와 S-E이 HMC-1 세포에 protein kinase인 PMA와 Calcium Ionophore안 A23187은 염증을 유발하여(Baek et al.) 생약복합추출물의 염증 억제를 평가함으로 알러지 질환의 예방 및 치료제 개발에 기초자료를 제공하고자 한다.

II. 재료 및 방법

1. 물질 추출

본 연구는 중국 의약서 외대비요의 처방을 기준으로, 칠백고(백지, 백련, 백출, 백복령, 백급, 백부자, 세신)를 건조된 생약을 구입하여 실험에 사용하였다. 약재를 추출하기 위해 백렴, 백지, 백출 각각 30g, 백급 15g, 백복령 9g, 백세신, 백부자, 각각 9g씩 총 51.0g을 70℃ 물 1ℓ를 2시간 동안 열수 추출하여 감압하여 5.7g을 얻었다(S-W). 동일한 양에 50℃ 70% 에탄올 1ℓ를 2시간 동안 교반하고 여과한 후 감압 농축하여 6.2g을 얻었다(S-E).

2. 실험방법

1) Human mast cell line(HMC-1) 배양 및 세포독성 측정

HMC-1를 2.0×10⁶/ml로 세포를 DMEM와 DNase type I, antibiotics를 넣고 37℃ CO₂ 배양기에서 3일간 배양하였다. 세포는 37℃, 5% CO₂ 배양기에서 배양하고 Trysin-EDTA 용액으로 분리한 후, 96 well plate에 2×10⁴개 세포로 분주한 후 배양기에서 24시간 배양하였다. 시료를 500, 250, 100, 50, 25, 12.5 ㎍/㎖ 처리하고 48시간 후 MTT 방법으로 처리하고 540 nm Micro plate reader에서 흡광도를 측정하여 세포독성을 확인하였다.

2) Real Time Quantitative RT-PCR

- HMC-1세포에서 RNA 추출 방법

HMC-1세포를 5×10⁴ 세포로 24 well plate에 분주하고, 여기에 200, 100, 10 ㎍/㎖과 CSA(양성대조군 10 ㎍/㎖)를 처리하고 1시간 후 PMA(25 ng/㎖) and A23187(1 μΜ)를 각각의 well에 첨가하여 8시간 동안 세포배양기에서 배양한 후 5분간 2,000 rpm에서 원심분리하였다. 원심분리한 다음 상층액을 제거하고, RNAzolB 500 ㎕를 첨가하여 용해될 때까지 Mix 하였다. 이 용액에 15초간 chloroform(CHCl₃) 50 ㎕를 첨가한 Mix하였다. Ice에 15분간 방치한 후 원심 분리기에서 13,000 rpm 분리한 후 약 200 ㎕ 상층액을 분리하여 200 ㎕의 2-propanol과 같은 양으로 혼합 후 Mix하여 ice 15분간 상온에 방치하였다. 다시 원심 분리기에서 13,000 rpm으로 분리한 후 80% EtOH로 wash하고 3분간 감압건조하여 RNA를 추출하였다. DEPC를 처리한 20 ㎕의 증류수에 추출한 RNA를 녹여 heating block기 75℃에서 불활성화 시킨 후 first strand cDNA 합성에 적용하였다.

- 역전사(reverse transcription) 중합효소 연쇄반응

역전사 반응은 총 RNA 3 ㎍을 DNase I 2U/tube를 37℃ heating block에서 30분간 reaction후 10분 동안 75℃에서 변성시키고, 2.5 ㎕ 10 mM dNTPs mix와 1 ㎕ random sequence hexanucleotides(25 pmole/25 ㎕)와 RNA inhibitor로 1 ㎕ RNase inhibitor(20 U/㎕)와 1 ㎕ 100 mM DTT, 4.5 ㎕ 5×RT buffer를 첨가한 후, 1 ㎕의 M-MLV RT (200 U/㎕)를 Mix하여 DEPC 처리된 DW로서 최종 20 ㎕로 최종 volum을 맞추어 실험에 적용하였다.

최종 20 ㎕의 반응 혼합액을 Mix하여 2,000 rpm에서 5초간 원심분리기로 침강하여 37℃ heating block에서 60분 동안 반응시켜 first-strand cDNA를 합성하였다. 이를 다시 95℃에서 5분 동안 유지하여 M-MLV RT를 불활성화시킨 후 합성이 마무리된 cDNA를 PCR에 사용하였다.

- Real Time Quantitative RT-PCR

HMC-1에서 총 RNA는 TRI 시약으로 분리하고 DNase I로 염색체의 DNA을 제거한다. 20분 동안 75℃에서 DNase과 5 ug을 넣어 총 RAN은 First Strand cDNA Synthesis kit로 cDNA으로 transcrition하였다.

Real-Time PCR은 Applied로 실험에 적용하였다. Probes는 6-carboxy-fluorescein로 라벨을 사용하고, beta-actin cDNA는 모든 cDNA와 동일 양을 포함한 cDAN 표본을 AmpliTaq Gold DNA Polymerase을 포함시켜 TaqMan Universal PCR로 증폭하였다.

PCR 조건은 40 cycles로 50℃에서 2분 동안 95℃과 10분 동안 60℃에서 15초로 진행하였다. 사용된 Probe는 다음과 같다.

human interleukin-6	AGCCCTGAGAAAGAGACATGTAACAAGAGTAACA
human interleukin 8	AGAGCTCTGTCTGGACCCCAAGGAAAAC
human glyceraldehyde-3-phosphatede hydrogenase (G3PDH)	CAAGCTTCCCGTTCTCAGCC
human TNF-αlpha	TGGCCCCAGGCAGTCAGATCATC

3) Histamin 측정

HMC-1 5×10⁴ 세포를 24 well plate에 추출물(200, 100, 50 ㎍/㎖)과 양성대조군 CsA(10 ㎍/㎖)를 처리하고, 인간 비만세포에서 PMA and A23187은 염증을 유도하는 매체체로 사용되어 각각의 well에 첨가하여 자극을 유도한다. 세포배양기에서 24시간 동안 배양한 후, 항체 anti-IgE를 coating 완충용액에 희석하여 microwell에 coating 하였다. 4℃에서 30분 방치한 후, 450 nm에서 ELISA reader로 흡광도를 측정하였다.

4) 통계처리

실험으로부터 얻은 결과는 mean±standard error로 분석하였으며, 유의성 검증은 Student’s T-test 분석법을 이용하여 실험결과에 적용하였다.

III. 결과 및 고찰

1. 세포독성에 미치는 영향

S-W의 세포독성을 측정한 결과 500, 200, 100, 50, 10 ㎍/㎖ 농도에서 생존율이 각각 87.6±2.5, 95.2±4.5, 97.8±3.7, 104.5 ±2.8, 103.2±4.6로 나타나, 200 ㎍/㎖ 이하 농도에서는 독성을 나타내지 않았다. S-E의 세포독성을 측정한 결과 500, 200, 100, 50, 10 ㎍/㎖ 농도에서 생존율이 각각 84.6±3.4, 94.5± 4.4, 95.4±2.1, 102.3±4.6, 104.5±2.8로 나타나, 200 ㎍/㎖ 이하 농도에서 독성을 나타내지 않았다(Fig. 1).

2. 사이토카인 발현에 미치는 영향

1) IL-8 mRNA 발현에 미치는 영향

IL-8은 강력한 염증 매개물질로, 주로 비만세포와 같은 면역세포에서 발현되어 염증 반응 시 호중구(neutrophil)를 활성화하고 이동시키는 역할을 한다(Balkwill, 2003). 본 연구에서는 대조군에서 IL-8 mRNA 발현은, 면역억제제인 CsA 처리군에서 IL-8 발현이 0.626±0.08로 유의미하게 감소하여 염증 반응을 억제하는 효과를 확인하였다. S-W에서 200, 100, 50 ㎍/㎖ 농도 투여군에서는 각각 0.618±0.11, 0.744±0.10, 0.97±0.15로 나타내었고, S-E에서 200, 100, 50 ㎍/㎖ 농도 투여군에서는 각각 0.80±0.10, 0.763±0.162, 0.823±0.076로 나타내었다. S-W, 200 ㎍/㎖ 농도에서 유의성 있는 효과를 나타내었고, S-E에서는 감소를 나타내었으나 유의적인 효과를 나타내지는 않아, S-W, 200 ㎍/㎖가 염증 반응 조절에 효과적인 작용을 나타내었다. 생리활성 물질은 항산화 및 면역 조절 작용을 통해 비만세포 활성화를 억제하는 것으로 보이며(Park et al., 2018), 이는 IL-8 발현 감소 효과로 나타낸다고 알려져 있다(Kim & Seo). 이와 같은 결과는 천연 추출물이 비만세포 활성화에 의한 염증 반응을 조절하는 데 있어 중요한 요소로 작용한다고 볼 수 있다(Fig. 2).

2) TNF-α mRNA 발현에 미치는 영향

TNF-α는 염증 및 면역 반응의 주요 매개물질로(Park et al., 2018), 비만세포를 포함한 다양한 면역세포에서 발현되어 염증성 사이토카인의 생산을 유도하고 염증 반응을 증폭시키는 역할을 한다(Balkwill, 2006). 이는 NF-κB 경로를 억제함으로써 TNF-α의 발현을 조절했을 가능성을 나타내었다(Kim et al., 2021). 본 연구에서는 HMC-1에서 TNF-α mRNA 유전자 발현은, CsA는 0.551±0.05, S-W에서 200, 100, 50 ㎍/㎖ 농도 투여군에서는 각각 0.718±0.063 0.780±0.057, 0.90±0.074로 나타내었고, S-E에서 200, 100, 50 ㎍/㎖ 농도 투여군에서는 각각 0.67±0.041 0.76±0.16, 0.813±0.158로 나타내었다. S-W와 S-E 200 ㎍/㎖ 농도에서 유의성 있는 효과를 나타내었다. 이는 Kim et al.(2009)의 생약복합조성물의 연구와 유사함을 나타내어 염증억제에 효과가 있는 것으로 나타내었으며, Yang & Lee(2020)의 연구결과와 유사하며 낮은 농도에서 효과를 나타내어 실험군의 효과를 입증하였다(Fig. 3).

3) IL-6 mRNA 발현에 미치는 영향

IL-6은 면역 반응과 염증성 질환에서 중요한 역할을 하는 사이토카인으로, 비만세포 및 기타 면역세포에서 발현되며 염증 반응을 증진시키고(Wu et al., 2019), IL-6는 염증 반응에서 IL-6의 발현을 조절하는 메커니즘으로 작용하며(Choi et al., 2017), T cell, monocytes, macrophage 등에 의해 생성되는 다발현 염증성 cytokine으로, B cell분화 유도와 T cell의 성장 분화 등의 기능을 가진다(Baggiolini, 2001).

본 연구에서는 HMC-1에서 TNF-α mRNA 유전자 발현은, CsA는 0.376±0.143, S-W에서 200, 100, 50 ㎍/㎖ 농도 투여군에서는 각각 0.407±0.08 0.673±0.159, 0.685±0.155로 나타내었고, S-E에서 200, 100, 50 ㎍/㎖ 농도 투여군에서는 각각 0.383±0.04, 0.64±0.056, 0.756±0.125로 나타내었다. S-W, 200 ㎍/㎖ 농도에서, S-E, 200, 100 ㎍/㎖ 농도에서 유의성 있는 효과를 나타내었다. 이러한 연구결과는 Kim et al.(2009)의 연구와 유사함을 나타내어 염증억제에 효과가 있는 것으로 사료된다(Fig. 4).

4) Histamin 분비량에 미치는 영향

히스타민은 알러지 반응 및 염증 과정에서 중요한 역할을 하는 분자로, 비만세포에서 방출되어 염증성 반응을 유발한다(Rubin, 2007; Seung & Sim, 2014). 히스타민은 비만세포에서 발생되는 탈과립 물질로 가려움증을 유발하는 매개물질로 알려져 있다(Church & Maurer, 2015). 히스타민은 H1 수용체를 통해 가려움증을 유발하고, 이를 완화시키는 항히스타민제는 거의 모든 종류의 알러지 질환과 염증성 피부 질환에서 가려움증 완화에 적용되고 있다(Greaves, 1996). 본 연구에서는 비만세포의 탈과립을 유도하는 compound 48/80으로(Kim et al., 2004), HMC-1에서 Histamin양을 측정한 결과, 정상군은 5.2±0.8 nmol로 나타난 반면, 대조군 79.7±4.9 nmol로 큰폭으로 증가하였다. 비교대조군인 CsA 투여군은 23.6±2.1 nmol로 나타나 대조군에 비하여 유의성 있는 감소를 나타내었고, S-W에서 100, 50, 10 ㎍/㎖ 농도 투여군에서는 각각 38.0±2.2 49.1±2.6, 82.9±4.5 nmol로 나타내었고, S-E에서 100, 50, 10 ㎍/㎖ 농도 투여군에서는 각각 28.0±3.4, 48.3±0.45, 73.3±1.5 nmol로 나타내었다. S-W, S-E 200, 100 ㎍/㎖ 농도에서 유의성 있는 효과를 나타내었다. 이는 섬애약쑥 추출물이 히스타민 억제효과와 유사함을 나타내어 알러지 질환의 반응인 가려움증 억제에 효과적인 것으로 사료된다(Lee et al., 2021)(Fig. 5).

IV. 결 론

본 연구는 S-W와 S-E의 알러지 억제에 미치는지 영향을 확인한 결과 다음과 같은 결론을 얻었다.

1. 항염작용에 대한 실험을 진행하기 위해 Human mast cell line(HMC-1)에 세포독성을 실험한 결과, S-W와 S-E의 독성을 보이지 않는 200 ㎍/㎖이하의 농도에서 실험에 적용 정하였다. HMC-1에 PMA(25 ng/㎖) and A23187(1 μΜ)로 자극한 결과 200 ㎍/㎖이하의 농도에서 Real Time Quantitative RT-PCR로 염증에 작용하는 사이토카인 IL-6, IL-8, TNF-α의 유전자를 증폭이 100 ㎍/㎖ 농도에서 유의미한 효과를 나타내었고, IL-6는 S-E가 100 ㎍/㎖에서도 유의미한 억제효과를 나타내었다. 이는 유사한 실험과 동일한 결과를 나타내어 알러지를 유발하는 염증에 효과적인 소재임을 증명하였다.

2. 알러지 반응에서 중요한 역할을 하는 히스타민은 가려움증을 유발하는 물질로 비만세포에서 발생되다. 이에 HMC-1에서 히스타민 억제를 확인한 결과, S-W와 S-E 100 ㎍/㎖에서도 유의미한 억제효과를 나타내어, 염증성 피부질환중 가려움증 완화에 효과적인 소재임을 증명하였다.

따라서 본 연구결과는 S-W와 S-E의 HMC-1에 PMA and A23187의 자극에 의해 발생된 염증억제, compound 48/80 자극에 의한 히스타민 억제를 확인하여, 향후에 알러지로 인한 피부염증과 가려움 억제를 위한 소재연구에 적극적인 활용과 다양한 연구를 진행할 가치가 있는 것으로 사료된다.

Fig. 1.

Effects of S-W and S-E on the viability of HMC-1 cell. HMC-1 cell were cultured with various concentration of S-W and S-E extract for 48 hr and the cell viability was measured by MTT method. The results were presented by the mean ± S.E (N=6).

Fig. 2.

Inhibitory effects of S-W and S-E on IL-8 mRNA quantitative real-time PCR in HMC-1. Inhibitory effects of S-W and S-E on IL-8 mRNA quantitative real-time PCR in HMC-1. HMC-1 were stimulated with PMA (25 ng/㎖) and A23187 (1 μΜ) co-cultured S-W and S-E concentration (200, 100, 50 ㎍/㎖) and cyclosporin A for 8 h and real-time PCR was used to determine relative IL-8 mRNA expression compared with control (CT). HMC-1 were normal group without treatment (WT). Statistically significant value compared with control group data by T test (^*p<0.05, ^**p<0.01, ^***p<0.001).

Fig. 3.

Inhibitory effects of S-W and S-E on TNF-α mRNA quantitative real-time PCR in HMC-1. HMC-1 were stimulated with PMA (25 ng/㎖) and A23187 (1 μΜ) co-cultured S-W and S-E concentration (200, 100, 50 ㎍/㎖) and cyclosporin A for 8h and real-time PCR was used to determine relative IL-8 mRNA expression compared with control (CT). HMC-1 were normal group without treatment (WT). Statistically significant value compared with control group data by T test (^*p<0.05, ^**p<0.01, ^***p<0.001).

Fig. 4.

Inhibitory effects of S-W and S-E on IL-6 mRNA quantitative real-time PCR in HMC-1. HMC-1 were stimulated with PMA (25 ng/㎖) and A23187 (1 μΜ) co-cultured S-W and S-E concentration (200, 100, 50 ㎍/㎖) and cyclosporin A for 8 h and real-time PCR was used to determine relative IL-8 mRNA expression compared with control(CT). HMC-1 were normal group without treatment(WT). Statistically significant value compared with control group data by T test (^*p<0.05, ^**p<0.01, ^***p<0.001).

Fig. 5.

Effect of S-W and S-E on histamine release in HMC-1. Human mast cell line were stimulated with compound 48/80 co-cultured S-W and S-E concentration (100, 50, 10 ㎍/㎖) and cyclosporin A (10 ㎍/㎖) for 24 h, histamine release level for analyzed by ELISA kit. The results are expressed the mean ± S.E (N=5). Statistically significant value compared with control group data by T test (^*p<0.05, ^**p<0.01, ^***p<0.001).

REFERENCES

Baek, S. I., Bae, J. H., Kim, J. Y., Sim, S. H., Kang, K. H., Lee, S. Y., Kam, C. W., & Park, D. I. (2008). Anti-allergic Inflammatory Effects of Hwangyounhaedog-tang on PMA Plus A23187-stimulated RBL-2H3 Cells. Korean J. Oriental Physiology & Pathology, 22(3), 600-606.

Baggiolini, M. (2001). Chemokines in pathology and medicine. J. Intern. Med, 250(2), 91-104, doi: 10.1046/j.1365-2796.2001.00867.x

Balkwill, F. (2003). Chemokines and cancer. Nature Reviews Cancer, 3(7), 582-591.

Balkwill, F. (2006). TNF-α in inflammation and cancer: The good, the bad, and the ugly. Nature Reviews Immunology, 6(5), 359-371.

Batchelor, D. C., Ezeamuzie, C. I., & Kaliner, M. A. (2019). Mast cell-derived TNF-alpha in allergic inflammation. Journal of Immunology Research, 43(2), 140-148.

Chang, S. H., Lee, B. E., Jung, D. S., Han, J. H., Park, J. A., Shim, S. B., Kim, S. W., & Kim, J. K. (2008). Cartilage and Bone Protection Effect of AIF, a water extract from three herbs. Kor. J. Pharmacogn, 39(1), 1-6.

Choi, Y., Lee, S., & Park, S. (2017). Inhibition of IL-6 expression by plant extracts and their molecular mechanisms. Journal of Ethnopharmacology, 212:50-60.

Church, M. K., & Maurer, M. (2015). H1-Antihistamines Dermatitis and Itch in Atopic. Experimental Dermatology, 24(5), 332-333.

Galli, S. J., Tsai, M., & Piliponsky, A. M. (2008). The development of allergic inflammation. Nature, 454(3), 445-454.

Greaves, M. W., & Wall, P. D. (1996). Pathophysiology of Itching. The Lancet, 348(9032), 938-940.

Kim, E. K., Lee, K. S., Chai, O. H., & Song, C. H. (2004). Inhibitory effect of Arctium lappa linne on compound 48/80-induced mast cell activation and vascular permeability. Korean J. Phys. Anthrop, 17(1), 55-66.

Kim, J. E., & Seo, S. H. (2024). Antioxidant and Anti-inflammatory Effects of Stemona japonica Extracts Based on Different Solvents. J. Kor. Soc. Cosmetol, 30(6), 1416-1423.

Kim, S. Y., Kim, S. J., & Park, J. H. (2021). Natural extracts with anti-inflammatory properties: Effects on mast cell-mediated cytokine production. Journal of Ethnopharmacology, 250.

Kim, J. J., Jo, S. K., Jung, U. H., Park, H. R., & Yee, S. T. (2009). Inhibitory Effects of a Herbal Composition (HemoHIM) on the Activation of Human Mast Cell Line (HMC-1). Journal of Life Science, 19(12), 1808-1814.

Kim, S. R., Lee, S. Y., & Park, S. H. (2018). Anti-inflammatory effects of Seven White herbal extract on mast cell-mediated allergic inflammation. Journal of Ethnopharmacology, 224:124-132.

Lee, H. J., Lim, H. J., & Lim, M. H. (2021). Effect of Seomaeyakssuk (Artemisia argyi H.) Extracts on Anti-pruritic Activities. Journal of the Korean Applied Science and Technology, 38(5), 1292-1301.

Lee, J. H., Kim, S. H., & Moon, P. D. (2020). Regulation of mast cell degranulation and cytokine production by herbal extracts. Phytomedicine, 69:153215.

Metz, M., Maurer, M., & Mast, S. (2007). Mast cells: Key effector cells in immune responses. Trends in Immunology, 28(5), 234-241.

Moon, P. D., Kim, H. M., & Jeong, H. J. (2014). Inhibitory effects of natural products on mast cell activation in allergic inflammation. International Journal of Molecular Sciences, 15(11), 18813-18835.

Park, H. J., Lee, H. S., & Lee, S. H. (2018). Regulation of inflammatory cytokine production by herbal extracts in mast cell activation. Phytotherapy Research, 32(6), 1206-1215.

Park, H. S., Lee, S. H., & Kim, E. S. (2018). Suppressive effects of natural plant extracts on mast cell-mediated TNF-α production. Phytotherapy Research, 32(3), 462-471.

Rubin, B. K. (2007). Histamine in the pathogenesis of asthma. Journal of Allergy and Clinical Immunology, 120(3), 531-534.

Stone, K. D., Prussin, C., & Metcalfe, D. D. (2010). IgE, mast cells, basophils and eosinophils. Journal of Allergy and Clinical Immunology, 125(2 Suppl 2), S73-S80.

Subramanian, H., Gupta, K., & Ali, H. (2016). Roles of histamine in mast cell-mediated allergy and inflammation. Handbook of Experimental Pharmacology, 241:41-63.

Yang, Y. X., & Lee, J. A. (2020). Improvement of Antioxidant and Anti-inflammatory Activities of Fermented Notoginseng Extracts. J. Kor. Soc. Cosmetol, 26(1), 154-159.

Seung, Y. C., & Sim, B. Y. (2014). Effect of CGT on Atopic Dermatitis in DNCB-Induced NC/Nga Mouse. Kor. Soc. Cosmetol, 20(3), 470-477.

Wu, H., Dong, L., & Liu, L. (2019). IL-6 and inflammation in immune responses. International Journal of Molecular Sciences, 20(1), 30-42.