J Korean Soc Cosmetol > Volume 27(5); 2021 > Article
Lactobacillus gasseri HDB1102를 활용한 신규 화장품 소재의 미세먼지에 의해 유발되는 피부증상 완화 효과

Abstract

In this study, we developed Dermabiotics HDB1102 using Lactobacillus gasseri HDB1102 to relieve skin irritation caused by particulate matter (PM). L. gasseri HDB1102 was provided from cell bank and identified by 16S ribosomal RNA gene sequencing. Dermabiotics HDB1102 was manufactured by heating, centrifuging, and filtering culture medium of L. gasseri HDB1102. When 0-2.5%(v/v) Dermabiotics HDB1102 was treated, cytotoxicity on normal human epidermal keratinocytes (NHEKs) and human fibroblast was not observed by using MTT assay. The mRNA expression levels of cytochrome P450 1A1 (CYP1A1), interleukin (IL)-1β, and IL-8 on Dermabiotics HDB1102 treated cells decreased compared to PM-treated cells. Conversely, the mRNA expressions of aquaporin-3 (AQP-3), CD-44, and collagen type 1 (COL-1) on Dermabiotics HDB1102 treated cells were dose-dependent higher than those of non-treated cells. These results indicated that Dermabiotics HDB1102 have anti-inflammatory, moisturizing, and anti-wrinkle effects and could be used as a potential cosmetic ingredient to alleviate skin symptoms caused by PM.

I. 서 론

피부는 몸 안의 수분 증발을 막고 해로운 외부인자가 들어오는 것을 방지하는 중요한 기관이다(Lee et al., 2013). 하지만 자외선, 화학물질, 스트레스 등의 환경적 요인에 지속적으로 노출되면 피부는 항상성을 잃게 되는데, 최근 미세먼지(particulate matter, PM)가 피부 손상의 주요 원인으로 주목을 받고 있다(Han & Mood, 2020). 미세먼지는 입자의 크기에 따라 직경이 10 μm 이하인 일반 미세먼지(PM10)와 직경이 2.5 μm 이하인 초미세먼지(PM2.5)로 분류되며, 먼지부유물, 흙먼지, 금속 산화물 및 다환 방향족 탄화수소(polycyclic aromatic hydrocarbon, PAHs)와 같이 다양한 화학물질이 포함된 오염물질이다(Choi et al., 2020). 세계보건기구(World Health Organization, WHO)는 전 세계 인구의 92% 이상이 대기오염으로 인해 건강에 악영향을 받고 있으며, 미세먼지로 인해 연간 700만 명이 조기 사망하고 있다고 보고하였다. 또한, 호흡기, 심혈관, 피부와 관련된 여러 질병과 미세먼지의 상관관계에 대한 연구도 꾸준히 보고되고 있다(Lee et al., 2019).
미세먼지는 머리카락 단면 직경의 1/20배의 크키로 입자가 매우 작기 때문에 피부에 쉽게 달라붙어 가려움증, 발진과 같은 일시적인 피부자극을 유발하거나 모낭을 통해 피부 안까지 침투해 피부세포를 손상시켜 노화나 아토피 피부염 등 만성피부질환을 일으키기도 한다(Choi et al., 2020; Lee et al., 2019). 미세먼지에 의한 피부질환 발생 기작은 일반적으로 산화적 스트레스(oxidative stress)에 의한 세포독성으로 알려져 있다. 피부 내부로 침투한 미세먼지는 활성산소(reactive oxygen species, ROS)를 생산하여 산화적 스트레스를 유발하고 tumor necrosis factor (TNF)-α, interleukin (IL)-1α, IL-6, IL-8과 같은 염증성 사이토카인(proinflammatory cytokines)의 발현을 유도한다(Kim et al., 2016; Lee et al., 2019). 또한, 활성산소는 matrix metalloproteinase (MMP)-1, MMP-9과 같은 콜라게나아제(collagenase)를 활성화시켜 피부 장벽을 손상시키고 더 나아가 피부 노화, 건선, 아토피 피부염과 같은 피부질환을 일으키는 것으로 보고되고 있다(Arooj & Koh, 2019; Park et al., 2019).
해마다 반복되는 중국 발 황사와 산업화로 인해 미세먼지에 대한 심각성이 커져가는 상황이다. 따라서 미세먼지로 인한 피부증상을 완화하고 궁극적으로 피부질환을 예방할 수 있는 화장품 소재 개발의 필요성이 높아지고 있다. 피부건강에 대한 관심과 함께 마이크로바이옴(microbiome)과 피부와의 연관성이 주목을 받으면서 유산균을 활용한 화장품개발이 증가하고 있다. 유산균은 대표적인 프로바이오틱스(probiotics) 균주 중 하나로, 과민성대장증후군 증상완화와 같은 장 건강효과와 아토피 피부염 증상완화 및 피부산도 개선과 같은 피부 건강효과가 이미 입증되었다(Han et al., 2019; Lee et al., 2008; Sinn et al., 2008). 유산균의 피부 건강효과에 대한 선행연구는 장-피부축 이론(gut-skin axis)을 바탕으로 유산균의 섭취에 따른 효과를 입증한 것이 대다수였으나 최근 들어 피부에 바르는 형태로 유산균을 활용한 연구가 점차 증가하는 추세이다(Knackstedt et al., 2020; Kober & Bowe, 2015). 특히, 가열, 가압, 초음파파쇄 등 다양한 방법으로 유산균을 파쇄한 세포파쇄물(cell lysate)이 피부장벽강화, 주름개선에 효과가 있다고 보고되고 있다(Jung et al., 2019; Lim et al., 2020).
미세먼지에 노출된 피부는 앞서 언급하듯이 피부 민감성 증가(1단계)-피부장벽의 손상에 따른 보습력 저하(2단계)-피부수분함량 감소에 따른 피부탄력저하(3단계)의 피부노화 단계(cascade)를 거치게 된다. 따라서 본 연구는 Lactobacillus gasseri HDB1102를 활용한 화장품 소재의 민감성 감소-피부보습-피부탄력으로 이어지는 안티폴루션 효과를 입증하는데 목적을 두었다.

II. 재료 및 방법

1. 균주 동정 및 배양

본 연구에 사용된 HDB1102 균주는 ㈜현대바이오랜드의 세포은행(HYUNDAI BIOLAND Cell Bank, HDBCB)로부터 분양 받았으며, 동정(identification)을 위해 16S ribosomal RNA 유전자 염기서열을 분석하였다. 이를 위해 HDB1102 genomic DNA를 추출하고 Escherichia coli의 16S rDNA 서열을 기준으로 제작한 primers를 이용하여 PCR로 16S rDNA를 증폭시켰다. 이 서열을 기반으로 미국 국립생물정보센터(National Center for Biotechnology Information, NCBI; USA)의 Basic Local Alignment Search Tool (BLAST) 프로그램으로 유사성이 높은 Lactobacillus 속의 유산균 염기서열을 선별하고 Clustal X (Des Higgins, Germany)로 다중정렬한 후, 계통유전수를 작성하고 neighbor-joining 방법으로 그 위치를 확인하고 BLAST2 프로그램을 이용한 쌍정렬을 실시함으로써 동일 종(species)에 속하는 서열들과의 상동성(homology)을 비교하였다.
분양 균주는 MRS broth (BD, Becton, Dickinson and Company, New Jersey, USA)에 접종하여 37°C, 18시간 정치 배양하여 활성화시켰다. 활성화된 유산균은 본 실험에서 사용하기 전, 50% glycerol 용액과 1:1(v/v)로 섞어 -70°C의 초저온 냉동고에 앰플 상태로 보관하였다.

2. 유산균 시료 제조

실험에 사용한 유산균 시료(Dermabiotics HDB1102)를 아래와 같이 제조하였다. L. gasseri HDB1102를 MRS broth에 접종하고 37°C, 30시간 배양 후, 20,000×g, 10분간 원심분리하여 균체를 회수하였다. 회수한 균체를 멸균 증류수로 2회 세척한 뒤, 멸균 증류수에 현탁하고 0.12 MPa, 2시간 동안 열압추출 조건으로 세포를 파쇄하였다. 이후, 원심분리 및 나노막여과 공정을 통해 상등액을 회수하여 유산균 시료를 제조하였다.

3. 세포독성 측정

인간 표피 세포주(normal human epidermal keratinocytes, NHEKs; gibco, USA)과 인간 섬유아 세포주(human fibroblast; ATCC, USA)에 대한 유산균 시료의 세포독성을 3-(4,5-dimethylthoazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT; Promega, USA) assay로 측정하였다(Kim et al., 2020). 24-well plate에 1.5×105 cells/well의 농도로 각 세포를 접종하였다. 24시간 배양 후, 유산균 시료 원액을 100% (v/v)로 가정하여 serum free Epilife (Cascade Biologics, USA) 배지로 0, 0.1, 0.5, 1, 1.5, 2, 2.5% (v/v)의 농도로 희석하고 농도별 희석액을 동일한 용량으로 각 well당 1 mL씩 교체 및 처리하였다. 배양 후, 상등액을 제거하고 0.25 mg/mL의 MTT 용액과 반응시키고 dimethyl sulfoxide (DMSO)를 첨가하여 생성된 MTT 포르마잔(formazan)을 용해시켜 570 nm에서 흡광도를 측정하였다.

4. 피부 민감성관련 유전자 발현량 측정

유산균 시료의 민감성 완화 효과를 확인하기 위해 cytochrome P450 1A1 (CYP1A1), IL-1β, IL-8의 유전자 발현량을 측정하였다(Shin et al., 2020). NHEKs를 6-well plate에 6×106 cells/well의 농도로 접종하여 37°C, 5% CO2 배양기에서 24시간 배양하였다. Hanks’ balanced salt solution (HBSS)으로 세척 후, 10 μg/mL PM을 포함한 serum free Epilife 배지로 최종 농도가 20 μM 레스베라트롤(resveratrol, RVT), 0, 1, 2, 2.5%(v/v) 농도의 유산균 시료가 되게 희석 및 처리하고 24시간 배양하였다. 배양이 끝나면 QIAzolTM Lysis 시약(Qiagen, Germany)을 처리하여 Applied Biosystem (USA) 방법에 따라 RNA를 추출 후 정량하였다. cDNA합성 후 real-time PCR (Applied Biosystems 7500 FAST real-time PCR system)을 수행하였다. PCR에 사용된 primers는 Table 1과 같다.

5. 피부 보습관련 유전자 발현량 측정

유산균 시료의 보습효과를 확인하기 위해 AQP-3, CD-44의 유전자 발현량을 측정하였다(Kim et al., 2016). 60 mm cell culture dish에 NHEKs를 37°C, 5% CO2 배양기에서 24시간 배양한 뒤, serum free Epilife 배지로 최종 농도가 100 nM 레티노산(retinoic acid), 0, 1, 2, 2.5% (v/v) 농도의 유산균 시료가 되게 희석 및 처리하고 24시간 배양하였다. 배양이 끝나면 이전의 방법과 동일하게 RNA 추출 및 cDNA 합성 후, Table 1의 primers를 이용하여 real-time PCR을 수행하였다.

6. 피부 탄력관련 유전자 발현량 측정

유산균 시료의 탄력 효과를 확인하기 위해 COL-1 유전자 발현량을 측정하였다(Lee et al., 2019). 60 mm cell culture dish에 human fibroblast를 37°C, 5% CO2 배양기에서 24시간 배양한 뒤, serum free DMEM (Dulbecco’s Modified Eagle Medium, Welgene, Korea) 배지로 최종 농도가 10 0 μg/mL 비타민 C(vitamin C, Vit C), 0, 1, 2, 2.5% (v/v) 농도의 유산균 시료가 되게 희석 및 처리하고 24시간 배양하였다. 배양이 끝나면 이전의 방법과 동일하게 RNA 추출 및 cDNA 합성 후, Table 1의 primers를 이용하여 real-time PCR을 수행하였다.

7. 통계분석

모든 실험결과는 독립적인 3회 반복 실험하였고, 결과는 평균값과 표준편차로 나타내었다. 이후 각 유전자의 mRNA의 상대적 발현량을 β-actin를 기준으로 비교하였으며, 통계분석은 SPSS Statics 19.0 (SPSS Inc.)를 사용하여 Mann-Whitney U test로 분석하였다.

III. 결과 및 고찰

1. HDB1102 균주의 동정결과

NCBI의 BLAST 프로그램을 이용하여 HDB1102 균주의 16S rRNA 유전자 염기서열을 분석한 결과, 99%의 상동성으로 Lactobacillus gasseri으로 동정되었다(Fig. 1). 따라서 본 연구에 사용된 HDB1102 균주는 L. gasseri HDB1102로 명명하였으며(GenBank accession No. MK235146, KCCM12342P), L. gasseri HDB1102 균주로 개발된 바르는 화장품 소재를 유산균시료(Dermabiotics HDB1102)로 명명하였다.

2. 유산균 시료의 세포독성 결과

피부 표피층의 세포주인 NHEKs와 피부 진피층의 fibroblast에 대한 세포독성을 MTT assay로 확인하였다. Human fibroblast에 유산균 시료를 처리한 결과, 모든 농도군에서 대조군 대비 세포사멸(apoptosis)이 발생되지 않았으며(Fig. 2B), NHEKs에서는 오히려 세포 증식이 일어나는 것을 확인하였다(Fig. 2A). 이를 통해 본 실험에 사용된 유산균 시료는 피부세포주에 대해 독성이 없으며, 향후 화장품 소재로 활용되었을 때 안전하게 사용될 수 있을 것으로 사료되었다.

3. 유산균 시료의 피부 민감성 완화 효과

미세먼지에 의한 피부손상 기작은 aryl hydrocarbon receptor (AhR) 활성화에 의한 활성산소 생성 기작으로 알려져 있다(Arooj & Koh, 2019). 미세먼지에 포함되어 있는 PAHs 종류 중 하나인 벤조피렌(benzo(a)pyrene, BaP)은 피부 속으로 들어가 AhR과 결합 및 BaP-AhR 복합체를 이루어 핵안으로 이동한 후, AhR unclear translocator (ARNT)와 결합하여 CYP1A1 발현을 유도하고 활성산소 생성을 촉진한다(Kim et al., 2016). 이렇게 생성된 활성산소는 피부세포에 산화적 스트레스를 유발하여 extracellular signal-regulated kinase (ERK), c-Jun N-terminal kinase (JNK), p38 등를 포함하는 MAPK 신호전달 경로를 활성화 시키고, nuclear factor-κB (NF-κB), activator protein-1 (AP-1)과 같은 전사인자의 발현을 증가시켜 TNF-α, IL-1β, IL-6, IL-8 등 염증성 사이토카인의 발현을 유도한다(Arooj & Koh, 2019; Choi et al., 2020).
유산균 시료의 피부 민감성 완화 효과를 확인하기 위해 PM을 처리한 NHEKs에 유산균 시료를 처리한 후, 염증과 관련된 유전자 발현량을 평가한 결과, 농도구배적으로 CYP1A1, IL-1β, IL-8의 발현량이 감소하였다(Fig. 3). 유산균 시료를 2.5% (v/v) 처리 시, CYP1A1 유전자 발현량은 양성대조군인 레스베라트롤을 처리한 수준으로 감소하여 PM 처리군 대비 약 30% 감소하였다(Fig. 3A). IL-1β 유전자 발현량은 2.5% (v/v) 유산균 시료 처리 시, 대조군 대비 약 19% 감소하였으며(Fig. 3B), IL-8에 대해서는 대조군 대비 약 27% 감소하였다(Fig. 3C). 위 결과를 통해 유산균 시료는 CYP1A1, IL-1β, IL-8의 유전자 발현량을 억제하여 항염증 효과를 나타냄을 확인하였다.
Khmaladze et al.(2018)은 UVB를 조사한 인공피부에 Lactobacillus reuteri DSM 17938 세포파쇄물을 처리한 결과, IL-6와 IL-8의 발현량이 유의적으로 감소함을 확인하였다. 또한, Kimoto-Nira et al.(2019)은 UVB를 조사한 NHEKs에서 Lactococcus lactis H61를 가열한 세포파쇄물의 처리가 IL-8의 발현량을 감소시킴을 확인하였다. 본 연구와는 다르게 미세먼지로 염증을 유도한 것은 아니지만 UVB 조사를 통해 산화적 스트레스를 일으켜 염증반응과 세포사멸을 유도하였으며, 유산균 파쇄물이 염증성 사이토카인의 발현을 억제함으로써 항염증 효과가 있음을 이전 연구를 통해서 확인할 수 있었다.

4. 유산균 시료의 피부 보습 효과

먼지부유물, 화학물질과 납, 카드뮴 등의 중금속이 포함된 미세먼지는 피부의 신진대사를 방해하고 피지조절 기능을 약화시켜 피부장벽 손상을 유발한다(Seo et al., 2016). 손상된 피부장벽은 가려움증, 건조증, 발진 등의 피부질환으로 발전될 수 있기 때문에 피부 보습을 유지하는 것이 중요하다(Yang et al., 2021). AQP-3와 CD-44는 피부장벽의 수분유지에 중요한 단백질로, 피부 표피층에서 주로 발현되는 AQP-3는 세포간 수분과 글리세롤의 이동 통로이며, CD-44는 세포막에 존재하는 막관통 단백질로 히알루론산(hyaluronic acid)의 수용체이다(Lee et al., 2016).
유산균 시료를 농도별로 NHEKs에 처리한 후, 피부 보습관련 유전자 발현량을 평가한 결과, 농도구배적으로 AQP-3, CD-44 유전자 발현량이 증가하였다(Fig. 4). 유산균 시료를 2.5% (v/v) 처리 시, AQP-3 유전자 발현량은 대조군 대비 30% 증가하였으며(Fig. 4A), CD-44 유전자 발현량은 대조군 대비 14% 이상 증가하였다(Fig. 4B). 위 결과를 통해 유산균 시료는 AQP-3와 CD-44 발현을 촉진하여 보습 효과를 나타냄을 확인하였다.
Kim et al.(2020)은 가열처리한 Lactobacillus plantarum K8 세포파쇄물이 HaCaT 세포에서 히알루론산의 생성량을 증가시키고 HAS-2와 AQP-3 발현량을 증가시킴을 확인하였다. 위의 선행연구에서도 유산균 파쇄물이 피부세포의 히알루론산의 합성과 수분이동량을 증가시킴으로써 피부보습 효과의 가능성을 제시하고 있다.

5. 유산균 시료의 탄력손상 예방 효과

피부의 탄력성은 진피에 존재하는 콜라겐(collagen)에 의해 유지된다. 콜라겐은 진피의 85-90 %를 차지하는 세포외기질의 주요 구성성분으로 섬유아세포에서 생성되며 콜라게나아제에 의해 분해되는 단백질이다(Kim et al., 2012). 미세먼지는 피부세포를 자극해 활성산소 생성량을 증가시키는데, 활성산소는 콜라게나아제를 활성화시켜 피부 내 콜라겐을 분해한다(Lee et al., 2019).
유산균 시료를 농도별로 human fibroblast에 처리한 후, 피부 탄력관련 유전자 발현량을 평가한 결과, 농도구배적으로 COL1 유전자 발현량이 증가하였다(Fig. 5). 특히, 유산균 시료 2.5% (v/v) 처리 시, COL-1 유전자 발현이 대조군 대비 35% 이상 증가하였으며, 양성대조군인 비타민 C보다 12% 이상의 높은 유전자 발현을 유도하였다. 위 결과를 통해 유산균 시료는 collagen type 1의 합성을 촉진하여 탄력 효과를 나타냄을 확인하였다.
Kim & Lee(2015)는 여성 손에서 분리한 유산균인 Lactobacillus rhamnosusLactobacillus paracasei 균체를 함께 초음파 파쇄한 후, human fibroblast에 처리하여 MMP-1 생성량 감소와 collagen type 1 생성량 증가를 통해 주름개선활성을 확인하였다. 또한, 가열처리한 Lactobacillus acidophilus KCCM12625P는 산화적 스트레스를 유발하기 위해 UVB를 조사한 human fibroblast에서 ERK와 c-Fos의 인산화를 막고 MMP-1, -2, -3, -9의 유전자 발현량을 감소시켰으며, collagen type 1 합성을 촉진시키는 것을 확인할 수 있었다(Lim et al., 2020). 위의 선행연구에서도 유산균 파쇄물이 피부세포의 콜라겐 합성을 촉진함으로써 탄력손상을 예방할 수 있는 가능성을 제시하고 있다.

IV. 결 론

본 연구에서는 미세먼지에 의해 유발되는 피부증상을 완화하기 위한 소재로 신규한 L. gasseri HDB1102 균주를 이용하여 피부에 바를 수 있는 화장품 소재(Dermabiotics HDB1102)를 개발하였다. NHEKs와 human fibroblast를 대상으로 유산균 시료의 세포독성을 확인한 결과, 최고 시험농도인 2.5% (v/v) 처리에도 독성을 나타내지 않아 화장품 소재로 활용 시, 피부에 안전함을 확인하였다. NHEKs에 미세먼지를 처리한 후, 유산균 시료를 처리한 결과, CYP1A1과 염증성 사이토카인인 IL1β, IL-8의 유전자 발현량을 유의적으로 감소시켰다. 또한, 유산균 시료는 피부 보습인자인 AQP-3, CD-44와 탄력인자인 COL-1의 유전자 발현량을 유의적으로 증가시켰다. 이러한 결과를 통해, 유산균 시료가 미세먼지로 인해 손상된 피부의 민감성을 감소시키고 보습과 탄력을 증가시킴으로써 기능성 유산균 화장품 소재로서의 가능성을 확인하였다.

Fig. 1.
Phylogenetic position of strain HDB1102 in the genus Lactobacillus based on the 16S rRNA sequence. The bar represented 0.002% sequence divergence.
JKSC-2021-27-5-1152f1.jpg
Fig. 2.
Cell cytotoxicity of Dermabiotics HDB1102 in (A) NHEKs and (B) human fibroblast. Data are shown as mean ± SD of three separate experiments. A difference between Dermabiotics HDB1102 and control was considered to be significant when *p < 0.05, **p < 0.01, and ***p < 0.001. Cont., non-treated cells; HDB1102, 1-2.5% of Dermabiotics HDB1102 treated cells.
JKSC-2021-27-5-1152f2.jpg
Fig. 3.
Anti-inflammatory effect of Dermabiotics HDB1102 on NHEKs. (A) CYP1A1, (B) IL-1β, and (C) IL-8 gene expression. Data are shown as mean ± SD of three separate experiments. A difference between Dermabiotics HDB1102 and control was considered to be significant when *p < 0.05 and ***p < 0.001. Cont., non-treated cells; PM, 10 μg/mL PM treated cells; PM+RVT, 10 μg/mL PM and 20 μM resveratrol treated cells; PM+HDB1102, 10 μg/mL PM and 1.0-2.5% of Dermabiotics HDB1102 treated cells.
JKSC-2021-27-5-1152f3.jpg
Fig. 4.
Moisturizing effect of Dermabiotics HDB1102 on NHEKs. (A) AQP-3 and (B) CD-44 gene expression. Data are shown as mean ± SD of three separate experiments. A difference between Dermabiotics HDB1102 and control was considered to be significant when *p < 0.05, **p < 0.01, and ***p < 0.001. Cont., non-treated cells; Retinoic acid, 100 nM retinoic acid treated cells; HDB1102, 1.0-2.5% of Dermabiotics HDB1102 treated cells.
JKSC-2021-27-5-1152f4.jpg
Fig. 5.
Anti-wrinkle effect of Dermabiotics HDB1102 on human fibroblast. Data are shown as mean ± SD of three separate experiments. A difference between Dermabiotics HDB1102 and control was considered to be significant when **p < 0.01 and ***p < 0.001. Cont., non-treated cells; Vit C, 100 μg/mL vitamin C treated cells; HDB1102, 1.0-2.5% of Dermabiotics HDB1102 treated cells.
JKSC-2021-27-5-1152f5.jpg
Table 1.
Sequences of primers used in real-time PCR
Primer Orientation Sequence (5’→3’)
Cytochrome P450 1A1 (CYP1A1) Forward GGGACCAGTCGGAAGGGAT
Reverse CACAGATGGACAGGCTGCCT
Interleukin-8 (IL-8) Forward CTGGCCGTGGCTCTCTTG
Reverse CCTTGGCAAAACTGCACCTT
Interleukin-1β (IL-1β) Forward ACGAATCTCCGACCACCACT
Reverse TCCATGGCCACAACAACTGA
Aquaporin-3 (AQP-3) Forward GGGACCAGTCGGAAGGGAT
Reverse CACAGATGGACAGGCTGCCT
CD-44 Forward GCTATTGAAAGCCTTGCAGAG
Reverse CGCAGATCGATTTGAATATAACC
Collagen type 1 (COL-1) Forward AGCAAGAACCCCAAGGACAA
Reverse CGAACTGGAATCCATCGGTC
β-Actin Forward GGCACCCAGCACAATGAAG
Reverse CCGATCCACACGGAGTACTTG

References

Arooj, M., & Koh, Y. S. (2019 Role of particulate matter in skin inflammation. Journal of Bacteriology and Virology, 49(25), 89-92. doi: 10.4167/jbv.2019.49.2.89.
crossref
Choi, J. K., Choi, I. S., Cho, K. K., & Lee, S. H. (2020 Harmfulness of particulate matter in disease progression. Korean Society of Life Science, 30(2), 191-201. doi: 10.5352/JLS.2020.30.2.191.
Han, M. H., & Moon, G. S. (2020 Development of skin health promoting materials using Leuconostoc mesenteroides. Microbiology and Biotechnology Letters, 48(4), 455-462. doi: 10.48022/mbl.2005.05005.
crossref
Han, S., Shin, J., Lim, S., Ahn, H. Y., Kim, B., & Cho, Y. (2019 Dietary effect of Lactobacillus plantarum CJLP55 isolated from kimchi on skin pH and its related biomarker levels in adult subjects. Journal of Nutrition and Health, 52(2), 149-156. doi: 10.4163/jnh.2019.52.2.149.
crossref
Jung, Y. O., Jeong, H., Cho, Y., Lee, E. O., Jang, H. W., Kim, J., Nam, K. T., & Lim, K. M. (2019 Lysates of a probiotic, Lactobacillus rhamnosus, can improve skin barrier function in a reconstructed human epidermis model. International Journal of Molecular Sciences, 20:4289.doi: 10.3390/ijms20174289.
crossref pmc
Khmaladze, I., Butler, E., Fabre, S., & Gillbro, J. M. (2019 Lactobacillus reuteri DSM 17938-A comparative study on the effect of probiotics and lysates on human skin. Experimental Dermatology, 28:822-828. doi: 10.1111/exd.139503.
crossref pmid
Kim, D. W., Baek, T. S., Kim, T. J., Choi, S. K., & Lee, D. W. (2016 Moisturizing effect of jellyfish collagen extract. Journal of the Society of Cosmetic Scientists of Korea, 42(2), 153-162. doi: 10.15230/SCSK.2016.42.2.153.
crossref
Kim, H., Jeon, B., Kim, W. J., & Chung, D. K. (2020 Effect of paraprobiotic prepared from kimchi-derived Lactobacillus plantarum K8 on skin moisturizing activity in human keratinocyte. Journal of Functional Foods, 75:104244.doi: 10.1016/j.jff.2020.104244.
crossref
Kim, K. E., Cho, D., & Park, H. J. (2016 Air pollution and skin diseases: Adverse effects of airborne particulate matter on various skin diseases. Life Sciences, 152:126-134. doi: 10.1016/j.lfs.2016.03.039.
crossref pmid
Kim, M. J., Kwon, R. H., Jang, M. W., & Ha, B. J. (2012 Antioxidant and Anti-wrinkle effects of steamed three ginseng extracts. Journal of the Society of Cosmetic Scientists of Korea, 38(2), 155-162. doi: 10.15230/SCSK.2012.38.2.155.
crossref
Kim, N. Y., & Lee, H. Y. (2015 Enhancement of skin whitening and anti-wrinkle activities of the co-culture of Lactobacillus rhamnosus and Lactobacillus paracasei. Jouranl of Society of Cosmetic Scientists of Korea, 41(3), 253-261. doi: 10.15230/SCSK.2015.41.3.253.
crossref
Kimoto-Nira, H., Sekiyama, Y., & Moriya, N. (2019 Towards application of water extract from heat-killed Lactococcus lactis H61 as a cosmetic ingredient. Letters in Applied Microbiology, 68:530-536. doi: 10.1111/lam.13136.
pmid
Kim, Y. H., Park, H. R., Cha, S. Y., Lee, S. H., Jo, J. W., Go, J. N., Lee, K. H., Lee, S. Y., & Shin, S. S. (2020 Effect of red ginseng NaturalGEL on skin aging. Journal of Ginseng Research, 44(1), 115-122. doi: 10.1016/j.jgr.2018.09.006.
crossref pmid
Knackstedt, R., Knackstedt, T., & Gatherwright, J. (2020 The role of topical probiotics on skin conditions: A systematic review of animal and human studies and implications for future therapies. Experimental Dermatology, 00:1-7. doi: 10.1111/exd.14032.
Kober, M. M., & Bowe, W. P. (2015 The effect of probiotics on immune regulation, acne, and photoaging. International Journal of Women’s Dermatology, 1(2), 85-89. doi: 10.1016/j.ijwd.2015.02.001.
crossref
Lee, I. H., Lee, S. H., Lee, I. S., Park, Y. K., Chung, D. K., & Choue, R. (2008). Effects of probiotic extracts of kimchi on immune function in NC/Nga mice. Korean Journal of Food Science and Technology, 40(1), 82-87.
Lee, J., Kim, H., Kim, J., & Han, C. J. (2019). A study on the awareness of skin harmfulness and skin reaction symptoms and skin care behavior about the particulate matter of adult women. Journal of the Korean Society of Cosmetology, 25(6), 1309-1315.
Lee, S. H., Bae, I. H., Min, D. J., Kim, H. J., Park, N. H., Choi, J. H., Shin, J. S., Kim, E. J., & Lee, H. K. (2016 Skin hydration effect of Jeju lava sea water. Journal of the Society of Cosmetic Scientists of Korea, 42(4), 343-349. doi: 10.15230/SCSK.2016.42.4.343.
crossref
Lee, S. H., Min, D. J., Na, Y. J., Shim, J., Kwon, L. K., Cho, J. C., & Lee, H. K. (2013 The protective effect of mineral water against UVB irradiation. Journal of the Society of Cosmetic Scientists of Korea, 39(1), 39-46. doi: 10.15230/SCSK.2013.39.1.039.
crossref
Lee, Y. G., Lee, D. G., Gwang, J. E., Kim, M., Kim, M., Kim, H. G., Ko, J. H., Yeo, H., Kang, S., & Baek, N. I. (2019 A 1,1’-biuracil from Epidermidibacterium keratini EPI-7 shows anti-aging effects on human dermal fibroblasts. The Korean Society for Applied Biological Chemistry, 62:14.doi: 10.1186/s13765-019-0421-9.
Lim, H. Y., Jeong, D., Park, S. H., Shin, K. K., Hong, Y. H., Kim, E., Yu, Y. G., Kim, T. R., Kim, H., Lee, J., & Cho, J. Y. (2020 Antiwrinkle and antimelanogenesis effects of tyndallized Lactobacillus acidophilus KCCM12625P. International Journal of Molecular Sciences, 21:1620.doi: 10.3390/ijms21051620.
crossref pmc
Park, J. H., Oh, S. J., & Lee, J. H. (2019 Effects of particulate matter on healthy human skin: A panel study using a smartphone application measuring daily skin condition. Journal of the European Academy of Dermatology and Venereology, 33(7), 1363-1368. doi: 10.1111/jdv.15517.
crossref pmid
Seo, S. K., Ku, C. S., Son, B., Lee, S. G., Kang, E. M., Kim, M., Hong, J. H., Kim, S., & Shin, M. S. (2016 Anti-polluction capacity of mixtures of Anemarrhena asphodeloides root extract, β-glucan and poly-γ-glutamic acid from stimulation with particulate matter. Journal of Investigative Cosmetology, 12(4), 313-322. doi: 10.15810/jic.2016.12.4.004.
Shin, M. G., Park, E. Y., Park, D., & Kim, C. T. (2020 Relaxing effect of evening primrose root on skin irritation caused by particulate matter in subway tunnel. Journal of the Society of Cosmetic Scientists of Korea, 46(2), 119-131. doi: 10.15230/SCSK.2020.46.2.119.
Sinn, D. H., Song, J. H., Kim, H. J., Lee, J. H., Son, H. J., Chang, D. K., Kim, Y. H., Kim, J. J., Rhee, J. C., & Rhee, P. L. (2008 Therapeutic effect of Lactobacillus acdophilus-SDC 2012, 2013 in patients with irritable bowel syndrome. Digestive Diseases and Science, 53:2714-2718. doi: 10.1007/s10620-007-0196-4.
crossref
Yang, S. J., Lee, C. W., Cha, S. Y., Choi, J. W., & Lee, S. (2021 Skin barrier enhancement of ferment using lava seawater and Lactobacillus plantarum HDB1234 as a novel cosmetic ingredient. Journal of the Korean Society of Cosmetology, 27(2), 356-363. doi: 10.52660/JKSC.2021.27.2.356.
crossref


ABOUT
BROWSE ARTICLES
EDITORIAL POLICY
FOR CONTRIBUTORS
Editorial Office
95 Hoamro, Uijeongbu-city, Gyeonggi-do 11644, Korea
Tel: +82-10-2825-6735        E-mail: beauty2007@hanmail.net                

Copyright © 2022 by Korean Society of Cosmetology.

Developed in M2PI

Close layer
prev next